back Return to this vector's summary.
ID   PRSET6B    preliminary; circular DNA; SYN; 2830 BP.
XX
AC   X54207;
XX
DT   15-MAR-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pRSET6b - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-2830
RC   pRSET6b
RA   Schoepfer R.;
RT   ;
RL   Submitted (08-AUG-1990) by:
RL   Schoepfer R., Salk Institute, P.O.Box 85800, San Diego, CA 92138, USA.
XX
RN   [2]
RP   1-2830
RC   pRSET1d from pBluescript KS+ & pET-3d
RC   pRSET1a, pRSET1b, pRSET1c from pRSET1d & pET-3a
RC   pRSET5 series, pRSET6 series from pRSET1 series & linker MCS
RA   Schoepfer R.;
RT   "The pRSET family of T7 promoter expression vectors for Escherichia
RT   coli";
RL   Gene 124:83-85(1993).
XX
CC   This bacterial expression cloning vector contains a T7 promoter,
CC   transcription terminator, translation start site, pUC and phage f1
CC   origins of replication and a polylinker. The plasmid confers
CC   resistance to ampicillin.
CC
CC   See related entries X54202-X54209.
CC   NM (pRSET6B)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBluescript KS+)(pRSET)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBluescript KS+ PvuII-PvuII 2519bp
FT                   \ 978..2964..533
FT                   2. pET-3d BglII-EcoRV 280bp
FT                   Klenow:Klenow
FT                   -> pRSET1 2800bp
FT                   1. pRSET1 remove XbaI-BamHI 80bp, pET-3d/2720bp
FT                   2. pET-3b XbaI-BamHI 80bp
FT                   -> pRSET1b 2800bp
FT                   1. pRSET1b BamHI 2800bp
FT                   2. linker MCS BamHI-BamHI 46bp
FT                   \ agcttcgaattccatggtaccagctgcagatctcgagctcggatcc
FT                   -> pRSET6b 2830bp"
FT   misc_feature    1..317
FT                   /note="contains expression specific sequences"
FT   promoter        20..36
FT                   /note="PRO bacteriophage T7"
FT   misc_feature    37..37
FT                   /note="transcription start"
FT   misc_feature    100..102
FT                   /note="translation start"
FT   misc_binding    140..186
FT                   /note="MCS"
FT   misc_feature    292..292
FT                   /note="TER transcription stop"
FT   misc_feature    318..2830
FT                   /note="from pBluescript KS+"
XX
SQ   Sequence 2830 BP; 704 A; 697 C; 706 G; 723 T; 0 other;
     gatctcgatc ccgcgaaatt aatacgactc actataggga gaccacaacg gtttccctct
     agaaataatt ttgtttaact ttaagaagga gatatacata tggctagcat gactggtgga
     cagcaaatgg gtcgggatca agcttcgaat tccatggtac cagctgcaga tctcgagctc
     ggatccggct gctaacaaag cccgaaagga agctgagttg gctgctgcca ccgctgagca
     ataactagca taaccccttg gggcctctaa acgggtcttg aggggttttt tgctgaaagg
     aggaactata tccggatctg gcgtaatagc gaagaggccc gcaccgatcg cccttcccaa
     cagttgcgca gcctgaatgg cgaatgggac gcgccctgta gcggcgcatt aagcgcggcg
     ggtgtggtgg ttacgcgcag cgtgaccgct acacttgcca gcgccctagc gcccgctcct
     ttcgctttct tcccttcctt tctcgccacg ttcgccggct ttccccgtca agctctaaat
     cgggggctcc ctttagggtt ccgatttagt gctttacggc acctcgaccc caaaaaactt
     gattagggtg atggttcacg tagtgggcca tcgccctgat agacggtttt tcgccctttg
     acgttggagt ccacgttctt taatagtgga ctcttgttcc aaactggaac aacactcaac
     cctatctcgg tctattcttt tgatttataa gggattttgc cgatttcggc ctattggtta
     aaaaatgagc tgatttaaca aaaatttaac gcgaatttta acaaaatatt aacgcttaca
     atttaggtgg cacttttcgg ggaaatgtgc gcggaacccc tatttgttta tttttctaaa
     tacattcaaa tatgtatccg ctcatgagac aataaccctg ataaatgctt caataatatt
     gaaaaaggaa gagtatgagt attcaacatt tccgtgtcgc ccttattccc ttttttgcgg
     cattttgcct tcctgttttt gctcacccag aaacgctggt gaaagtaaaa gatgctgaag
     atcagttggg tgcacgagtg ggttacatcg aactggatct caacagcggt aagatccttg
     agagttttcg ccccgaagaa cgttttccaa tgatgagcac ttttaaagtt ctgctatgtg
     gcgcggtatt atcccgtatt gacgccgggc aagagcaact cggtcgccgc atacactatt
     ctcagaatga cttggttgag tactcaccag tcacagaaaa gcatcttacg gatggcatga
     cagtaagaga attatgcagt gctgccataa ccatgagtga taacactgcg gccaacttac
     ttctgacaac gatcggagga ccgaaggagc taaccgcttt tttgcacaac atgggggatc
     atgtaactcg ccttgatcgt tgggaaccgg agctgaatga agccatacca aacgacgagc
     gtgacaccac gatgcctgta gcaatggcaa caacgttgcg caaactatta actggcgaac
     tacttactct agcttcccgg caacaattaa tagactggat ggaggcggat aaagttgcag
     gaccacttct gcgctcggcc cttccggctg gctggtttat tgctgataaa tctggagccg
     gtgagcgtgg gtctcgcggt atcattgcag cactggggcc agatggtaag ccctcccgta
     tcgtagttat ctacacgacg gggagtcagg caactatgga tgaacgaaat agacagatcg
     ctgagatagg tgcctcactg attaagcatt ggtaactgtc agaccaagtt tactcatata
     tactttagat tgatttaaaa cttcattttt aatttaaaag gatctaggtg aagatccttt
     ttgataatct catgaccaaa atcccttaac gtgagttttc gttccactga gcgtcagacc
     ccgtagaaaa gatcaaagga tcttcttgag atcctttttt tctgcgcgta atctgctgct
     tgcaaacaaa aaaaccaccg ctaccagcgg tggtttgttt gccggatcaa gagctaccaa
     ctctttttcc gaaggtaact ggcttcagca gagcgcagat accaaatact gtccttctag
     tgtagccgta gttaggccac cacttcaaga actctgtagc accgcctaca tacctcgctc
     tgctaatcct gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt accgggttgg
     actcaagacg atagttaccg gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca
     cacagcccag cttggagcga acgacctaca ccgaactgag atacctacag cgtgagctat
     gagaaagcgc cacgcttccc gaagggagaa aggcggacag gtatccggta agcggcaggg
     tcggaacagg agagcgcacg agggagcttc cagggggaaa cgcctggtat ctttatagtc
     ctgtcgggtt tcgccacctc tgacttgagc gtcgattttt gtgatgctcg tcaggggggc
     ggagcctatg gaaaaacgcc agcaacgcgg cctttttacg gttcctggcc ttttgctggc
     cttttgctca catgttcttt cctgcgttat cccctgattc tgtggataac cgtattaccg
     cctttgagtg agctgatacc gctcgccgca gccgaacgac cgagcgcagc gagtcagtga
     gcgaggaagc ggaagagcgc ccaatacgca aaccgcctct ccccgcgcgt tggccgattc
     attaatgcag
//