back Return to this vector's summary.
ID   PRSET6C    preliminary; circular DNA; SYN; 2829 BP.
XX
AC   X54208;
XX
DT   15-MAR-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pRSET6c - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-2829
RC   pRSET6c
RA   Schoepfer R.;
RT   ;
RL   Submitted (08-AUG-1990) by:
RL   Schoepfer R., Salk Institute, P.O.Box 85800, San Diego, CA 92138, USA.
XX
RN   [2]
RP   1-2829
RC   pRSET1d from pBluescript KS+ & pET-3d
RC   pRSET1a, pRSET1b, pRSET1c from pRSET1d & pET-3a
RC   pRSET5 series, pRSET6 series from pRSET1 series & linker MCS
RA   Schoepfer R.;
RT   "The pRSET family of T7 promoter expression vectors for Escherichia
RT   coli";
RL   Gene 124:83-85(1993).
XX
CC   This bacterial expression cloning vector contains a T7 promoter,
CC   transcription terminator, translation start site, pUC and phage f1
CC   origins of replication and a polylinker. The plasmid confers
CC   resistance to ampicillin.
CC
CC   See related entries X54202-X54209.
CC   NM (pRSET5A)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBluescript KS+)(pRSET)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBluescript KS+ PvuII-PvuII 2519bp
FT                   \ 978..2964..533
FT                   2. pET-3d BglII-EcoRV 280bp
FT                   Klenow:Klenow
FT                   -> pRSET1 2800bp
FT                   1. pRSET1 remove XbaI-BamHI 80bp, pET-3d/2720bp
FT                   2. pET-3c XbaI-BamHI 80bp
FT                   -> pRSET1c 2800bp
FT                   1. pRSET1c BamHI 2800bp
FT                   2. linker MCS BamHI-BamHI 46bp
FT                   \ agcttcgaattccatggtaccagctgcagatctcgagctcggatcc
FT                   -> pRSET6c 2829bp"
FT   misc_feature    1..316
FT                   /note="contains expression specific sequences"
FT   promoter        20..36
FT                   /note="PRO bacteriophage T7"
FT   misc_feature    37..37
FT                   /note="transcription start"
FT   misc_feature    100..102
FT                   /note="translation start"
FT   misc_binding    139..185
FT                   /note="MCS"
FT   misc_feature    291..291
FT                   /note="TER transcription stop"
FT   misc_feature    317..2829
FT                   /note="from pBluescript KS+"
XX
SQ   Sequence 2829 BP; 704 A; 697 C; 705 G; 723 T; 0 other;
     gatctcgatc ccgcgaaatt aatacgactc actataggga gaccacaacg gtttccctct
     agaaataatt ttgtttaact ttaagaagga gatatacata tggctagcat gactggtgga
     cagcaaatgg gtcggatcaa gcttcgaatt ccatggtacc agctgcagat ctcgagctcg
     gatccggctg ctaacaaagc ccgaaaggaa gctgagttgg ctgctgccac cgctgagcaa
     taactagcat aaccccttgg ggcctctaaa cgggtcttga ggggtttttt gctgaaagga
     ggaactatat ccggatctgg cgtaatagcg aagaggcccg caccgatcgc ccttcccaac
     agttgcgcag cctgaatggc gaatgggacg cgccctgtag cggcgcatta agcgcggcgg
     gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag cgccctagcg cccgctcctt
     tcgctttctt cccttccttt ctcgccacgt tcgccggctt tccccgtcaa gctctaaatc
     gggggctccc tttagggttc cgatttagtg ctttacggca cctcgacccc aaaaaacttg
     attagggtga tggttcacgt agtgggccat cgccctgata gacggttttt cgccctttga
     cgttggagtc cacgttcttt aatagtggac tcttgttcca aactggaaca acactcaacc
     ctatctcggt ctattctttt gatttataag ggattttgcc gatttcggcc tattggttaa
     aaaatgagct gatttaacaa aaatttaacg cgaattttaa caaaatatta acgcttacaa
     tttaggtggc acttttcggg gaaatgtgcg cggaacccct atttgtttat ttttctaaat
     acattcaaat atgtatccgc tcatgagaca ataaccctga taaatgcttc aataatattg
     aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc cttattccct tttttgcggc
     attttgcctt cctgtttttg ctcacccaga aacgctggtg aaagtaaaag atgctgaaga
     tcagttgggt gcacgagtgg gttacatcga actggatctc aacagcggta agatccttga
     gagttttcgc cccgaagaac gttttccaat gatgagcact tttaaagttc tgctatgtgg
     cgcggtatta tcccgtattg acgccgggca agagcaactc ggtcgccgca tacactattc
     tcagaatgac ttggttgagt actcaccagt cacagaaaag catcttacgg atggcatgac
     agtaagagaa ttatgcagtg ctgccataac catgagtgat aacactgcgg ccaacttact
     tctgacaacg atcggaggac cgaaggagct aaccgctttt ttgcacaaca tgggggatca
     tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa gccataccaa acgacgagcg
     tgacaccacg atgcctgtag caatggcaac aacgttgcgc aaactattaa ctggcgaact
     acttactcta gcttcccggc aacaattaat agactggatg gaggcggata aagttgcagg
     accacttctg cgctcggccc ttccggctgg ctggtttatt gctgataaat ctggagccgg
     tgagcgtggg tctcgcggta tcattgcagc actggggcca gatggtaagc cctcccgtat
     cgtagttatc tacacgacgg ggagtcaggc aactatggat gaacgaaata gacagatcgc
     tgagataggt gcctcactga ttaagcattg gtaactgtca gaccaagttt actcatatat
     actttagatt gatttaaaac ttcattttta atttaaaagg atctaggtga agatcctttt
     tgataatctc atgaccaaaa tcccttaacg tgagttttcg ttccactgag cgtcagaccc
     cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt
     gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag agctaccaac
     tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg tccttctagt
     gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat acctcgctct
     gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta ccgggttgga
     ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac
     acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc gtgagctatg
     agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa gcggcagggt
     cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc tttatagtcc
     tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt caggggggcg
     gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct tttgctggcc
     ttttgctcac atgttctttc ctgcgttatc ccctgattct gtggataacc gtattaccgc
     ctttgagtga gctgataccg ctcgccgcag ccgaacgacc gagcgcagcg agtcagtgag
     cgaggaagcg gaagagcgcc caatacgcaa accgcctctc cccgcgcgtt ggccgattca
     ttaatgcag
//