back Return to this vector's summary.
ID   PRSET6D    preliminary; circular DNA; SYN; 2828 BP.
AC   X54209;
DT   15-MAR-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
DE   E. coli plasmid vector pRSET6d - complete.
KW   cloning vector.
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
RN   [1]
RP   1-2828
RC   pRSET6d
RA   Schoepfer R.;
RT   ;
RL   Submitted (08-AUG-1990) by:
RL   Schoepfer R., Salk Institute, P.O.Box 85800, San Diego, CA 92138, USA.
RN   [2]
RP   1-2828
RC   pRSET1d from pBluescript KS+ & pET-3d
RC   pRSET1a, pRSET1b, pRSET1c from pRSET1d & pET-3a
RC   pRSET5 series, pRSET6 series from pRSET1 series & linker MCS
RA   Schoepfer R.;
RT   "The pRSET family of T7 promoter expression vectors for Escherichia
RT   coli";
RL   Gene 124:83-85(1993).
CC   This bacterial expression cloning vector contains a T7 promoter,
CC   transcription terminator, translation start site, pUC and phage f1
CC   origins of replication and a polylinker. The plasmid confers
CC   resistance to ampicillin.
CC   See related entries X54202-X54209.
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBluescript KS+)(pRSET)
CC   BR ()
CC   OF ()
CC   OR ()
FH   Key             Location/Qualifiers
FT   misc_feature    0..0
FT                   /note="1. pBluescript KS+ PvuII-PvuII 2519bp
FT                   \ 978..2964..533
FT                   2. pET-3d BglII-EcoRV 280bp
FT                   Klenow:Klenow
FT                   -> pRSET1 2800bp
FT                   1. pRSET1 remove XbaI-BamHI 80bp, pET-3d/2720bp
FT                   2. pET-3d XbaI-BamHI 80bp
FT                   -> pRSET1d 2800bp
FT                   1. pRSET1d BamHI 2800bp
FT                   2. linker MCS BamHI-BamHI 46bp
FT                   \ agcttcgaattccatggtaccagctgcagatctcgagctcggatcc
FT                   -> pRSET6d 2828bp"
FT   misc_feature    1..315
FT                   /note="contains expression specific sequences"
FT   promoter        20..36
FT                   /note="PRO bacteriophage T7"
FT   misc_feature    37..37
FT                   /note="transcription start"
FT   misc_feature    99..101
FT                   /note="translation start"
FT   misc_binding    138..184
FT                   /note="MCS"
FT   misc_feature    290..290
FT                   /note="TER transcription stop"
FT   misc_feature    316..2828
FT                   /note="from pBluescript KS+"
SQ   Sequence 2828 BP; 703 A; 698 C; 705 G; 722 T; 0 other;
     gatctcgatc ccgcgaaatt aatacgactc actataggga gaccacaacg gtttccctct
     agaaataatt ttgtttaact ttaagaagga gatataccat ggctagcatg actggtggac
     agcaaatggg tcggatcaag cttcgaattc catggtacca gctgcagatc tcgagctcgg
     atccggctgc taacaaagcc cgaaaggaag ctgagttggc tgctgccacc gctgagcaat
     aactagcata accccttggg gcctctaaac gggtcttgag gggttttttg ctgaaaggag
     gaactatatc cggatctggc gtaatagcga agaggcccgc accgatcgcc cttcccaaca
     gttgcgcagc ctgaatggcg aatgggacgc gccctgtagc ggcgcattaa gcgcggcggg
     tgtggtggtt acgcgcagcg tgaccgctac acttgccagc gccctagcgc ccgctccttt
     cgctttcttc ccttcctttc tcgccacgtt cgccggcttt ccccgtcaag ctctaaatcg
     ggggctccct ttagggttcc gatttagtgc tttacggcac ctcgacccca aaaaacttga
     ttagggtgat ggttcacgta gtgggccatc gccctgatag acggtttttc gccctttgac
     gttggagtcc acgttcttta atagtggact cttgttccaa actggaacaa cactcaaccc
     tatctcggtc tattcttttg atttataagg gattttgccg atttcggcct attggttaaa
     aaatgagctg atttaacaaa aatttaacgc gaattttaac aaaatattaa cgcttacaat
     ttaggtggca cttttcgggg aaatgtgcgc ggaaccccta tttgtttatt tttctaaata
     cattcaaata tgtatccgct catgagacaa taaccctgat aaatgcttca ataatattga
     aaaaggaaga gtatgagtat tcaacatttc cgtgtcgccc ttattccctt ttttgcggca
     ttttgccttc ctgtttttgc tcacccagaa acgctggtga aagtaaaaga tgctgaagat
     cagttgggtg cacgagtggg ttacatcgaa ctggatctca acagcggtaa gatccttgag
     agttttcgcc ccgaagaacg ttttccaatg atgagcactt ttaaagttct gctatgtggc
     gcggtattat cccgtattga cgccgggcaa gagcaactcg gtcgccgcat acactattct
     cagaatgact tggttgagta ctcaccagtc acagaaaagc atcttacgga tggcatgaca
     gtaagagaat tatgcagtgc tgccataacc atgagtgata acactgcggc caacttactt
     ctgacaacga tcggaggacc gaaggagcta accgcttttt tgcacaacat gggggatcat
     gtaactcgcc ttgatcgttg ggaaccggag ctgaatgaag ccataccaaa cgacgagcgt
     gacaccacga tgcctgtagc aatggcaaca acgttgcgca aactattaac tggcgaacta
     cttactctag cttcccggca acaattaata gactggatgg aggcggataa agttgcagga
     ccacttctgc gctcggccct tccggctggc tggtttattg ctgataaatc tggagccggt
     gagcgtgggt ctcgcggtat cattgcagca ctggggccag atggtaagcc ctcccgtatc
     gtagttatct acacgacggg gagtcaggca actatggatg aacgaaatag acagatcgct
     gagataggtg cctcactgat taagcattgg taactgtcag accaagttta ctcatatata
     ctttagattg atttaaaact tcatttttaa tttaaaagga tctaggtgaa gatccttttt
     gataatctca tgaccaaaat cccttaacgt gagttttcgt tccactgagc gtcagacccc
     gtagaaaaga tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg
     caaacaaaaa aaccaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact
     ctttttccga aggtaactgg cttcagcaga gcgcagatac caaatactgt ccttctagtg
     tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg
     ctaatcctgt taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac
     tcaagacgat agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca
     cagcccagct tggagcgaac gacctacacc gaactgagat acctacagcg tgagctatga
     gaaagcgcca cgcttcccga agggagaaag gcggacaggt atccggtaag cggcagggtc
     ggaacaggag agcgcacgag ggagcttcca gggggaaacg cctggtatct ttatagtcct
     gtcgggtttc gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggggggcgg
     agcctatgga aaaacgccag caacgcggcc tttttacggt tcctggcctt ttgctggcct
     tttgctcaca tgttctttcc tgcgttatcc cctgattctg tggataaccg tattaccgcc
     tttgagtgag ctgataccgc tcgccgcagc cgaacgaccg agcgcagcga gtcagtgagc
     gaggaagcgg aagagcgccc aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat