back Return to this vector's summary.
ID   PS1        preliminary; circular DNA; SYN; 2770 BP.
XX
AC   ATCC77381;
XX
DT   03-FEB-1994 (Rel. 8, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pS1 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pS1 from pUC19 & oligo
RC   pS1-polyA from pS1 & pMAMneo
RC   pS1-MT from pS1 & pT24
RC   pS1-MMTV from pS1 & pMAMneo
RC   pS3 from pS1
RC   pS5 from pS3
RC   pK from pUC19 & oligo
RC   pM from pK & pS1-polyA & pS1-MMTV, RSV LTR/MMTV LTR
RC   pT from pK & pS1-polyA & pS1-MT, MT gene
RC   pM-hyg from pM & pHT, hyg gene
RC   pMB-hyg from pM-hyg & pS5, lacZ-amb
RC   pMB from pMB-hyg
RC   pT-hyg from pT & pHT, hyg gene
RC   pTB-hyg from pT-hyg & pS5, lacZ-amb
RC   pTB from pTB-hyg
RA   Wang Q., Maher V.M., McCormick J.J.;
RT   "Mammalian expression vectors with modulatable promoters and two
RT   multiple cloning sites";
RL   Gene 119:155-161(1992).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   Deposited by: J. Justin McCormick
CC   Cloning vector with the multiple cloning site expanded by inserting an
CC   oligonucleotide at the SmaI site of pUC19, thereby generating an amber
CC   mutation in the lacZ' coding sequence. [1]
CC   The plasmid contains the following restriction sites (bp from 0):
CC   DrdI--91, 992; KasI--233; PvuI--276, 2150; EcoRI--396; NotI--418;
CC   NsiI--493; HindIII--531; SapI--767; BsaI--1850; SspI--2585. (personal
CC   communication)
CC   The order of the major features in this plasmid is: KasI -
CC   3' lacZ'amb1 - EcoRI/MCS/HindIII - 5' lacZ'amb1 - SapI - pMB1 ori -
CC   ampR. [1]
CC   Restriction digests of the clone give the following sizes (kb):
CC   PvuI--1.9, 0.9; EcoRI--2.8; HindIII--2.8; NotI--2.8; SspI--2.8. (ATCC
CC   staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pS1)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli)(E.coli HB101)(E.coli JM109)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pUC19)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC19 SmaI 2686bp 415..415, MCS
FT                   2. oligo 84bp
FT                   \ gcgcggccgctcgcgaatcgatagctagcgcgcactagtctcgaggcgcc
FT                   \ ggcacgcgtacgagatctgttaacatgcatgcgc
FT                   -> pS1 2770bp"
FT   -               1..414
FT                   /note="pUC19 1..414 414bp
FT                   SmaI = XmaI = CCC^GGG
FT                   \                 gcgcg..."
FT   -               415..498
FT                   /note="84bp
FT                   \ gcgcggccgctcgcgaatcgatagctagcgcgcactagtctcgaggcgcc
FT                   \ ggcacgcgtacgagatctgttaacatgcatgcgc
FT                   \        ...tgcgc
FT                   SmaI = XmaI = CCC^GGG"
FT   -               499..2770
FT                   /note="pUC19 415..2686 2272bp"
FT   misc_binding    0..0
FT                   /note="MCS unique EcoRI-SstI-BanI-KpnI-NotI-NruI-ClaI-
FT                   NheI-BssHII-SpeI-XhoI-NarI-NaeI-MluI-SplI-BglII-
FT                   HpaI-NsiI-BamHI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   promoter        0..0
FT                   /note="PRO E. coli lac"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ');
FT                   amb1; reporter gene"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 2770 BP; 682 A; 702 C; 713 G; 673 T; 0 other;
     tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
     accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc
     attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat
     tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt
     tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgagctcggt acccgcgcgg
     ccgctcgcga atcgatagct agcgcgcact agtctcgagg cgccggcacg cgtacgagat
     ctgttaacat gcatgcgcgg ggatcctcta gagtcgacct gcaggcatgc aagcttggcg
     taatcatggt catagctgtt tcctgtgtga aattgttatc cgctcacaat tccacacaac
     atacgagccg gaagcataaa gtgtaaagcc tggggtgcct aatgagtgag ctaactcaca
     ttaattgcgt tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat
     taatgaatcg gccaacgcgc ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc
     tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca
     aaggcggtaa tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca
     aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg
     ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg
     acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt
     ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt
     tctcaatgct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc
     tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt
     gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt
     agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc
     tacactagaa ggacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa
     agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt
     tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct
     acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta
     tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa
     agtatatatg agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc
     tcagcgatct gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact
     acgatacggg agggcttacc atctggcccc agtgctgcaa tgataccgcg agacccacgc
     tcaccggctc cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt
     ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta
     agtagttcgc cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg
     tcacgctcgt cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt
     acatgatccc ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc
     agaagtaagt tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt
     actgtcatgc catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc
     tgagaatagt gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc
     gcgccacata gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa
     ctctcaagga tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac
     tgatcttcag catcttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa
     aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt
     tttcaatatt attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa
     tgtatttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct
     gacgtctaag aaaccattat tatcatgaca ttaacctata aaaataggcg tatcacgagg
     ccctttcgtc
//