back Return to this vector's summary.
ID   PS3        preliminary; circular DNA; SYN; 2752 BP.
XX
AC   IG9837;
XX
DT   01-JUL-1995 (Rel. 11, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pS3 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pS1 from pUC19 & oligo
RC   pS1-polyA from pS1 & pMAMneo
RC   pS1-MT from pS1 & pT24
RC   pS1-MMTV from pS1 & pMAMneo
RC   pS3 from pS1
RC   pS5 from pS3
RC   pK from pUC19 & oligo
RC   pM from pK & pS1-polyA & pS1-MMTV, RSV LTR/MMTV LTR
RC   pT from pK & pS1-polyA & pS1-MT, MT gene
RC   pM-hyg from pM & pHT, hyg gene
RC   pMB-hyg from pM-hyg & pS5, lacZ-amb
RC   pMB from pMB-hyg
RC   pT-hyg from pT & pHT, hyg gene
RC   pTB-hyg from pT-hyg & pS5, lacZ-amb
RC   pTB from pTB-hyg
RA   Wang Q., Maher V.M., McCormick J.J.;
RT   "Mammalian expression vectors with modulatable promoters and two
RT   multiple cloning sites";
RL   Gene 119:155-161(1992).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pS3)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)(E.coli HB101)(E.coli JM109)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pUC19)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pS1 remove EcoRI-NotI 22bp 397..415..(419),
FT                   \ MCS/pUC19 397..415..(419)/2748bp
FT                   fill in:fill in
FT                   -> pS3 2748bp"
FT   -               1..400
FT                   /note="pUC19 1..400 400bp
FT                   EcoRI = G^AATT C
FT                   NotI =      GC^GGCCGC
FT                   \              ggccgc..."
FT   -               401..480
FT                   /note="80bp
FT                   \ ggccgctcgcgaatcgatagctagcgcgcactagtctcgaggcgccggca
FT                   \ cgcgtacgagatctgttaacatgcatgcgc
FT                   \        ...tgcgc
FT                   SmaI = XmaI = CCC^GGG"
FT   -               481..2752
FT                   /note="pUC19 415..2686 2272bp"
FT   misc_binding    0..0
FT                   /note="MCS NruI-ClaI-NheI-BssHII-SpeI-XhoI-NarI-
FT                   NaeI-MluI-SplI-BglII-HpaI-HindIII"
FT   misc_binding    0..0
FT                   /note="SIT unique NruI-ClaI-NheI-BssHII-SpeI-XhoI-
FT                   NaeI-MluI-SplI-BglII-HpaI-HindIII"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   promoter        0..0
FT                   /note="PRO E. coli lac"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ');
FT                   amb5; reporter gene"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 2752 BP; 680 A; 694 C; 707 G; 671 T; 0 other;
     tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
     accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc
     attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat
     tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt
     tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt ggccgctcgc gaatcgatag
     ctagcgcgca ctagtctcga ggcgccggca cgcgtacgag atctgttaac atgcatgcgc
     ggggatcctc tagagtcgac ctgcaggcat gcaagcttgg cgtaatcatg gtcatagctg
     tttcctgtgt gaaattgtta tccgctcaca attccacaca acatacgagc cggaagcata
     aagtgtaaag cctggggtgc ctaatgagtg agctaactca cattaattgc gttgcgctca
     ctgcccgctt tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc
     gcggggagag gcggtttgcg tattgggcgc tcttccgctt cctcgctcac tgactcgctg
     cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta
     tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc
     aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc ccctgacgag
     catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac
     caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc
     ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcaatg ctcacgctgt
     aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc
     gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga
     cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta
     ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag aaggacagta
     tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga
     tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg
     cgcagaaaaa aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag
     tggaacgaaa actcacgtta agggattttg gtcatgagat tatcaaaaag gatcttcacc
     tagatccttt taaattaaaa atgaagtttt aaatcaatct aaagtatata tgagtaaact
     tggtctgaca gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt
     cgttcatcca tagttgcctg actccccgtc gtgtagataa ctacgatacg ggagggctta
     ccatctggcc ccagtgctgc aatgataccg cgagacccac gctcaccggc tccagattta
     tcagcaataa accagccagc cggaagggcc gagcgcagaa gtggtcctgc aactttatcc
     gcctccatcc agtctattaa ttgttgccgg gaagctagag taagtagttc gccagttaat
     agtttgcgca acgttgttgc cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt
     atggcttcat tcagctccgg ttcccaacga tcaaggcgag ttacatgatc ccccatgttg
     tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg tcagaagtaa gttggccgca
     gtgttatcac tcatggttat ggcagcactg cataattctc ttactgtcat gccatccgta
     agatgctttt ctgtgactgg tgagtactca accaagtcat tctgagaata gtgtatgcgg
     cgaccgagtt gctcttgccc ggcgtcaata cgggataata ccgcgccaca tagcagaact
     ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa aactctcaag gatcttaccg
     ctgttgagat ccagttcgat gtaacccact cgtgcaccca actgatcttc agcatctttt
     actttcacca gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga
     ataagggcga cacggaaatg ttgaatactc atactcttcc tttttcaata ttattgaagc
     atttatcagg gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa
     caaatagggg ttccgcgcac atttccccga aaagtgccac ctgacgtcta agaaaccatt
     attatcatga cattaaccta taaaaatagg cgtatcacga ggccctttcg tc
//