back Return to this vector's summary.
ID   PS5        preliminary; circular DNA; SYN; 2714 BP.
XX
AC   ATCC77382;
XX
DT   03-FEB-1994 (Rel. 8, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pS5 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pS1 from pUC19 & oligo
RC   pS1-polyA from pS1 & pMAMneo
RC   pS1-MT from pS1 & pT24
RC   pS1-MMTV from pS1 & pMAMneo
RC   pS3 from pS1
RC   pS5 from pS3
RC   pK from pUC19 & oligo
RC   pM from pK & pS1-polyA & pS1-MMTV, RSV LTR/MMTV LTR
RC   pT from pK & pS1-polyA & pS1-MT, MT gene
RC   pM-hyg from pM & pHT, hyg gene
RC   pMB-hyg from pM-hyg & pS5, lacZ-amb
RC   pMB from pMB-hyg
RC   pT-hyg from pT & pHT, hyg gene
RC   pTB-hyg from pT-hyg & pS5, lacZ-amb
RC   pTB from pTB-hyg
RA   Wang Q., Maher V.M., McCormick J.J.;
RT   "Mammalian expression vectors with modulatable promoters and two
RT   multiple cloning sites";
RL   Gene 119:155-161(1992).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   Deposited by: J. Justin McCormick
CC   Cloning vector with a different multiple cloning site in lacZ',
CC   generating an amber mutation in the lacZ' coding sequence. [1]
CC   Derived from pS1 (ATCC 77381) by deletion of some restriction sites.
CC   [1]
CC   The plasmid contains the following restriction sites (bp from 0):
CC   DrdI--91, 932; KasI--233; BglI--245; PvuI--276, 2090; NruI--209;
CC   HindIII--471; SapI--707; EarI--708; BsaI--1790; SspI--2525. (personal
CC   communication)
CC   The order of the major features in this plasmid is: KasI -
CC   3' lacZ'amb5 - NruI/MCS/HindIII - 5' lacZ'amb5 - SapI - pMB1 ori -
CC   ampR. [1]
CC   Restriction digests of the clone give the following sizes (kb):
CC   PvuI--1.8, 0.9; BglI--1.6, 1.1; HindIII--2.7; SspI--2.7; NruI--2.7.
CC   (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pS5)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli)(E.coli HB101)(E.coli JM109)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pUC19)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pS1 remove EcoRI-NotI 22bp 397..415..(419),
FT                   \ MCS/pUC19 397..415..(419)/2748bp
FT                   fill in:fill in
FT                   -> pS3 2748bp
FT                   1. pS3 remove NsiI-HindIII 39bp (409)..415..448,
FT                   \ MCS//pUC (409)..415..448/2710bp
FT                   \ pUC 448..2686..397 & oligo 5..80
FT                   fill in:fill in
FT                   -> pS5 2710bp"
FT   -               1..400
FT                   /note="pUC19 1..400 400bp
FT                   EcoRI = G^AATT C
FT                   NotI =      GC^GGCCGC
FT                   \              ggccgc..."
FT   -               401..475
FT                   /note="75bp
FT                   \ ggccgctcgcgaatcgatagctagcgcgcactagtctcgaggcgccggca
FT                   \ cgcgtacgagatctgttaacatgca
FT                   \  ...catgca
FT                   NsiI = ATGCA^T = AvaIII = ATGCAT
FT                   HindIII =  A^AGCTT"
FT   -               476..2714
FT                   /note="pUC19 448..2686 2239bp"
FT   misc_binding    0..0
FT                   /note="MCS NruI-ClaI-NheI-BssHII-SpeI-XhoI-NarI-
FT                   NaeI-MluI-SplI-BglII-HpaI-HindIII"
FT   misc_binding    0..0
FT                   /note="SIT unique NruI-ClaI-NheI-BssHII-SpeI-XhoI-
FT                   NaeI-MluI-SplI-BglII-HpaI-HindIII"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   promoter        0..0
FT                   /note="PRO E. coli lac"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ');
FT                   amb5; reporter gene"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 2714 BP; 673 A; 683 C; 694 G; 664 T; 0 other;
     tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
     accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc
     attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat
     tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt
     tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt ggccgctcgc gaatcgatag
     ctagcgcgca ctagtctcga ggcgccggca cgcgtacgag atctgttaac atgcaagctt
     ggcgtaatca tggtcatagc tgtttcctgt gtgaaattgt tatccgctca caattccaca
     caacatacga gccggaagca taaagtgtaa agcctggggt gcctaatgag tgagctaact
     cacattaatt gcgttgcgct cactgcccgc tttccagtcg ggaaacctgt cgtgccagct
     gcattaatga atcggccaac gcgcggggag aggcggtttg cgtattgggc gctcttccgc
     ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca
     ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg
     agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca
     taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa
     cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc
     tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc
     gctttctcaa tgctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct
     gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg
     tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag
     gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta
     cggctacact agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg
     aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt
     tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt
     ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag
     attatcaaaa aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat
     ctaaagtata tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc
     tatctcagcg atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat
     aactacgata cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc
     acgctcaccg gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag
     aagtggtcct gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag
     agtaagtagt tcgccagtta atagtttgcg caacgttgtt gccattgcta caggcatcgt
     ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg
     agttacatga tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt
     tgtcagaagt aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc
     tcttactgtc atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc
     attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa
     taccgcgcca catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg
     aaaactctca aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc
     caactgatct tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag
     gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt
     cctttttcaa tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt
     tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc
     acctgacgtc taagaaacca ttattatcat gacattaacc tataaaaata ggcgtatcac
     gaggcccttt cgtc
//