back Return to this vector's summary.
ID   PSG424     preliminary; circular DNA; SYN; 4978 BP.
XX
AC   IG8003;
XX
DT   01-DEC-1994 (Rel. 10, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pSG424 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pSG424 from pECE
RA   Sadowski I., Ptashne M.;
RT   "A vector for expressing GAL4(1-147) fusions in mammalian cells";
RL   Nucleic Acids Res. 17:7539-7539(1989).
XX
RN   [2]
RC   plasmid from pLSV40 & oligo
RC   pECE from plasmid & linker
RC   [pMT21 from pMT series]
RC   pRB from pMT21 & hlR cDNA
RC   pT from pRB & hlR cDNA
RC   peT from pECE & pT
RC   plasmid2 from peT & M13mp19
RC   peYF1, peYF3 from plasmid2 & pECE
RC   from peT & pECE
RA   Ellis L., Clauser E., Morgan D.O., Edery M., Roth R.A., Rutter W.J.;
RT   "Replacement of insulin receptor tyrosine residues 1162 and 1163
RT   compromises insulin-stimulated kinase activity and uptake of
RT   2-deoxyglucose";
RL   Cell 45:721-732(1986).
XX
RN   [3]
RC   pM1 from pSG424 & pSP72 & pMTL23
RC   pM2, pM3 from pM1
RC   plasmid from pMH76 & linker
RC   pY1 from pM1 & plasmid
RC   pY2 from pM2 & plasmid
RC   pY3 from pM3 & plasmid
RC   pM1VP16 from pCRF2 & pM1
RC   pM2VP16 from pCRF1 & pM2
RC   pM3VP16 from pCRF3 & pM3
RC   pY1VP16 from pCRF2 & pM1
RC   pY2VP16 from pCRF1 & pM2
RC   pY3VP16 from pCRF3 & pM3
RA   Sadowski I., Bell B., Broad P., Hollis M.;
RT   "GAL4 fusion vectors for expression in yeast or mammalian cells";
RL   Gene 118:137-141(1992).
XX
RN   [4]
RC   pDN3 from YEplac112 & GAL4 gene
RC   YCpG4 from YCplac22 & GAL4 gene
RC   from YIplac128 & GAL4 gene
RA   Sadowski I., Niedbala D., Wood K., Ptashne M.;
RT   "GAL4 is phosphorylated as a consequence of transcriptional
RT   activation";
RL   Proc. Natl. Acad. Sci. U.S.A. 88:10510-10514(1991).
XX
RN   [5]
RC   pKLC15 from GAL4 gene
RC   pMA210 from GAL4 gene
RA   Ma J., Ptashne M.;
RT   "Deletion analysis of GAL4 defines two transcriptional activating
RT   segments";
RL   Cell 48:847-853(1987).
XX
RN   [6]
RC   pMH76 from pUC19 & ARS/CEN6 & TRP1 & GAL4 gene
RA   Hollis M.;
RT   ;
RL   Unpublished (1991).
XX
RN   [7]
RC   pMA424 from GAL4 gene
RA   Ma J., Ptashne M.;
RT   "A new class of yeast transcriptional activators";
RL   Cell 51:113-119(1987).
XX
RN   [8]
RC   pSV40 from pBR322 & SV40
RC   pLSV40 from pSV40 & linker
RA   Valenzuela P., Heberlein U., Mullenbach G.;
RT   ;
RL   Unpublished (1986).
XX
RN   [9]
RC   pMT1 from adenovirus major late promoter
RC   pMT2 from pMT1
RC   pMT3 from pMT2
RC   pMT21 from pMT2
RA   Kaufman R.J., Davies M.V., Pathak V.K., Hershey J.W.;
RT   "The phosphorylation state of eucaryotic initiation factor 2
RT   alters translational efficiency of specific mRNAs";
RL   Mol. Cell. Biol. 9:946-958(1989).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   MCS. oligonucleotide linker.
CC   NM (YCpGAL1)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pUC19)(pBM272)(YCplac111)(pCRF)(pBR322)(SV40)
CC   BR (YCpGAL2)(YCpGAL3)
CC   OF (pDBD)
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 BamHI 4361bp 376..376
FT                   2. SV40 BamHI 5243bp 2534..2534
FT                   -> pSV40 9604bp
FT                   1. pSV40 HindIII 9604bp, SV40 5172..5172
FT                   Klenow
FT                   BclI 9608bp, SV40 2271..2271
FT                   2. linker BglII-SmaI-XbaI 26bp
FT                   \ agatctcccgggtctagataagtaat
FT                   -> pLSV40 (OL/PL) 9634bp
FT                   1. pLSV40 (OL/PL) remove KpnI-AatII 3987bp,
FT                   \ SV40 299..4286/pBR322 AatII 4291/5647bp
FT                   T4 DNA polymerase:T4 DNA polymerase
FT                   -> plasmid 6200bp
FT                   1. plasmid remove NdeI-SalI 1645bp, pBR322 652..2297
FT                   \ 4600bp
FT                   \ SV40 NdeI 3811 4829 no SalI
FT                   Klenow:Klenow
FT                   2. linker BglII-HindIII-SalI-KpnI-SmaI-EcoRI-SstI-XbaI
FT                   \ 39bp gatctaagcttgtcgacggtaccccggggaattcgagct
FT                   -> pECE 4600bp
FT                   1. pECE remove HindIII-EcoRI 23bp,
FT                   \ linker MCS/4600bp
FT                   2. yeast HindIII-EcoRI 424bp, GAL4(1-147) gene/#K01486
FT                   \ pGAD424 424bp 410..834 [544bp]
FT                   \ agctttgcaaagatggataaagcggaattaattcccgagcctccaaaaaa
FT                   \ gaagagaaaggtcgaattgggtaccgccgccaattttaatcaaagtggga
FT                   \ atattgctgatagctcattgtccttcactttcactaacagtagcaacggt
FT                   \ ccgaacctcataacaactcaaacaaattctcaagcgctttcacaaccaat
FT                   \ tgcctcctctaacgttcatgataacttcatgaataatgaaatcacggcta
FT                   \ gtaaaattgatgatggtaataattcaaaaccactgtcacctggttggacg
FT                   \ gaccaaactgcgtataacgcgtttggaatcactacagggatgtttaatac
FT                   \ cactacaatggatgatgtatataactatctattcgatgatgaagataccc
FT                   \ caccaaacccaaaaaaagagatcg
FT                   -> pSG424 4473bp"
FT   -               1..1976
FT                   /note="SV40 295..2270 1976bp
FT                   BclI = T^GATCA
FT                   \        gatct..."
FT   -               1977..2001
FT                   /note="gatctcccgggtctagataagtaat 25bp
FT                   \ ...aagtaat
FT                   BclI =     T^GATCA"
FT   -               2002..2264
FT                   /note="SV40 2271..2533 263bp
FT                   BamHI = G^GATCC"
FT   -               2265..2544
FT                   /note="pBR322 376..655 280bp
FT                   SalI = G^TCGA C
FT                   \             gatcta..."
FT   -               2545..2550
FT                   /note="gatcta 6bp
FT                   \    gatcta
FT                   HindIII = A^AGCTT"
FT   -               2551..2974
FT                   /note="424bp
FT                   \ agctttgcaaagatggataaagcggaattaattcccgagcctccaaaaaa
FT                   \ gaagagaaaggtcgaattgggtaccgccgccaattttaatcaaagtggga
FT                   \ atattgctgatagctcattgtccttcactttcactaacagtagcaacggt
FT                   \ ccgaacctcataacaactcaaacaaattctcaagcgctttcacaaccaat
FT                   \ tgcctcctctaacgttcatgataacttcatgaataatgaaatcacggcta
FT                   \ gtaaaattgatgatggtaataattcaaaaccactgtcacctggttggacg
FT                   \ gaccaaactgcgtataacgcgtttggaatcactacagggatgtttaatac
FT                   \ cactacaatggatgatgtatataactatctattcgatgatgaagataccc
FT                   \ caccaaacccaaaaaaagagatcg
FT                   \ ...gatcg
FT                   EcoRI =  G^AATTC
FT                   \          aattcgagct"
FT   -               2975..2984
FT                   /note="aattcgagct 10bp
FT                   \ aattcgagct
FT                   NdeI =    CA^TATG"
FT   -               2985..4978
FT                   /note="pBR322 2297..4290 1994bp
FT                   AatII =      GACGT^C
FT                   KpnI = Asp718I = G GTAC^C"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 4978 BP; 1355 A; 1121 C; 1193 G; 1309 T; 0 other;
     gtacctaacc aagttcctct ttcagaggtt atttcaggcc atggtgctgc gccggctgtc
     acgccaggcc tccgttaagg ttcgtaggtc atggactgaa agtaaaaaaa cagctcaacg
     cctttttgtg tttgttttag agcttttgct gcaattttgt gaaggggaag atactgttga
     cgggaaacgc aaaaaaccag aaaggttaac tgaaaaacca gaaagttaac tggtaagttt
     agtctttttg tcttttattt caggtccatg ggtgctgctt taacactgtt gggggaccta
     attgctactg tgtctgaagc tgctgctgct actggatttt cagtagctga aattgctgct
     ggagaggccg ctgctgcaat tgaagtgcaa cttgcatctg ttgctactgt tgaaggccta
     acaacctctg aggcaattgc tgctataggc ctcactccac aggcctatgc tgtgatatct
     ggggctcctg ctgctatagc tggatttgca gctttactgc aaactgtgac tggtgtgagc
     gctgttgctc aagtggggta tagatttttt agtgactggg atcacaaagt ttctactgtt
     ggtttatatc aacaaccagg aatggctgta gatttgtata ggccagatga ttactatgat
     attttatttc ctggagtaca aacctttgtt cacagtgttc agtatcttga ccccagacat
     tggggtccaa cactttttaa tgccatttct caagcttttt ggcgtgtaat acaaaatgac
     attcctaggc tcacctcaca ggagcttgaa agaagaaccc aaagatattt aagggacagt
     ttggcaaggt ttttagagga aactacttgg acagtaatta atgctcctgt taattggtat
     aactctttac aagattacta ctctactttg tctcccatta ggcctacaat ggtgagacaa
     gtagccaaca gggaagggtt gcaaatatca tttgggcaca cctatgataa tattgatgaa
     gcagacagta ttcagcaagt aactgagagg tgggaagctc aaagccaaag tcctaatgtg
     cagtcaggtg aatttattga aaaatttgag gctcctggtg gtgcaaatca aagaactgct
     cctcagtgga tgttgccttt acttctaggc ctgtacggaa gtgttacttc tgctctaaaa
     gcttatgaag atggccccaa caaaaagaaa aggaagttgt ccaggggcag ctcccaaaaa
     accaaaggaa ccagtgcaag tgccaaagct cgtcataaaa ggaggaatag aagttctagg
     agttaaaact ggagtagaca gcttcactga ggtggagtgc tttttaaatc ctcaaatggg
     caatcctgat gaacatcaaa aaggcttaag taaaagctta gcagctgaaa aacagtttac
     agatgactct ccagacaaag aacaactgcc ttgctacagt gtggctagaa ttcctttgcc
     taatttaaat gaggacttaa cctgtggaaa tattttgatg tgggaagctg ttactgttaa
     aactgaggtt attggggtaa ctgctatgtt aaacttgcat tcagggacac aaaaaactca
     tgaaaatggt gctggaaaac ccattcaagg gtcaaatttt catttttttg ctgttggtgg
     ggaacctttg gagctgcagg gtgtgttagc aaactacagg accaaatatc ctgctcaaac
     tgtaacccca aaaaatgcta cagttgacag tcagcagatg aacactgacc acaaggctgt
     tttggataag gataatgctt atccagtgga gtgctgggtt cctgatccaa gtaaaaatga
     aaacactaga tattttggaa cctacacagg tggggaaaat gtgcctcctg ttttgcacat
     tactaacaca gcaaccacag tgcttcttga tgagcagggt gttgggccct tgtgcagatc
     tcccgggtct agataagtaa taagctgaca gcttgtatgt ttctgctgtt gacatttgtg
     ggctgtttac caacacttct ggaacacagc agtggaaggg acttcccaga tattttaaaa
     ttacccttag aaagcggtct gtgaaaaacc cctacccaat ttcctttttg ttaagtgacc
     taattaacag gaggacacag agggtggatg ggcagcctat gattggaatg tcctctcaag
     tagaggaggt tagggtttat gaggacacag aggagcttcc tggggatcct ctacgccgga
     cgcatcgtgg ccggcatcac cggcgccaca ggtgcggttg ctggcgccta tatcgccgac
     atcaccgatg gggaagatcg ggctcgccac ttcgggctca tgagcgcttg tttcggcgtg
     ggtatggtgg caggccccgt ggccggggga ctgttgggcg ccatctcctt gcatgcacca
     ttccttgcgg cggcggtgct caacggcctc aacctactac tgggctgctt cctaatgcag
     gagtcgcata agggagagcg tcgagatcta agctttgcaa agatggataa agcggaatta
     attcccgagc ctccaaaaaa gaagagaaag gtcgaattgg gtaccgccgc caattttaat
     caaagtggga atattgctga tagctcattg tccttcactt tcactaacag tagcaacggt
     ccgaacctca taacaactca aacaaattct caagcgcttt cacaaccaat tgcctcctct
     aacgttcatg ataacttcat gaataatgaa atcacggcta gtaaaattga tgatggtaat
     aattcaaaac cactgtcacc tggttggacg gaccaaactg cgtataacgc gtttggaatc
     actacaggga tgtttaatac cactacaatg gatgatgtat ataactatct attcgatgat
     gaagataccc caccaaaccc aaaaaaagag atcgaattcg agcttatgcg gtgtgaaata
     ccgcacagat gcgtaaggag aaaataccgc atcaggcgct cttccgcttc ctcgctcact
     gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta
     atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag
     caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc
     cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta
     taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg
     ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc
     tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac
     gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac
     ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg
     aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga
     aggacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt
     agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag
     cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct
     gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg
     atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta aagtatatat
     gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc
     tgtctatttc gttcatccat agttgcctga ctccccgtcg tgtagataac tacgatacgg
     gagggcttac catctggccc cagtgctgca atgataccgc gagacccacg ctcaccggct
     ccagatttat cagcaataaa ccagccagcc ggaagggccg agcgcagaag tggtcctgca
     actttatccg cctccatcca gtctattaat tgttgccggg aagctagagt aagtagttcg
     ccagttaata gtttgcgcaa cgttgttgcc attgctgcag gcatcgtggt gtcacgctcg
     tcgtttggta tggcttcatt cagctccggt tcccaacgat caaggcgagt tacatgatcc
     cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag
     ttggccgcag tgttatcact catggttatg gcagcactgc ataattctct tactgtcatg
     ccatccgtaa gatgcttttc tgtgactggt gagtactcaa ccaagtcatt ctgagaatag
     tgtatgcggc gaccgagttg ctcttgcccg gcgtcaacac gggataatac cgcgccacat
     agcagaactt taaaagtgct catcattgga aaacgttctt cggggcgaaa actctcaagg
     atcttaccgc tgttgagatc cagttcgatg taacccactc gtgcacccaa ctgatcttca
     gcatctttta ctttcaccag cgtttctggg tgagcaaaaa caggaaggca aaatgccgca
     aaaaagggaa taagggcgac acggaaatgt tgaatactca tactcttcct ttttcaatat
     tattgaagca tttatcaggg ttattgtctc atgagcggat acatatttga atgtatttag
     aaaaataaac aaataggggt tccgcgcaca tttccccgaa aagtgccacc tgacgtct
//