back Return to this vector's summary.
ID   PSK15      preliminary; circular DNA; SYN; 2709 BP.
XX
AC   IG5054; S38358;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pSK15 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pSK15 from pUC18 & lambda
RC   pSK16 from M13mp18 & lambda
RC   pSK28 from pSK15 & pSU11, bsuRIM gene
RC   pSK30 from pSK28 & pES2
RA   Kim S., Posfai G., Szybalski W.;
RT   "A novel gene-fusing vector: construction of a 5'-GGmCC-specific
RT   chimeric methyltransferase, M.BspRI/M.BsuRI";
RL   Gene 100:45-50(1991).
XX
RN   [2]
RC   pSU1, pSU11 from pBR322 & bsuRIM gene
RC   pSU12 from pSU1
RC   pSU19 from pBR322 & pSU12
RC   pSU13 from pSU1
RC   pSU15 from pSU1
RC   pSU184-11 from pACYC184 & pSU11
RA   Kiss A., Posfai G., Keller C.C., Venetianer P., Roberts R.J.;
RT   "Nucleotide sequence of the BsuRI restriction-modification system";
RL   Nucleic Acids Res. 13:6403-6421(1985).
XX
RN   [3]
RC   pES2 from pBR322 & Bacillus sphaericus R modification gene
RC   pM3, pM10 from pES2
RA   Posfai G., Kiss A., Erdei S., Posfai J., Venetianer P.;
RT   "Structure of the Bacillus sphaericus R modification gene";
RL   J. Mol. Biol. 170:597-610(1983).
XX
RN   [4]
RC   pSU2 from Bacillus subtilis phage SPbetaB methylase gene
RC   pS24 from pSU2
RC   pSU21, pSU22, pSU23 from pSU series
RA   Baldauf F., Kiss A.;
RT   "[Expression of the cloned modification methylase gene from
RT   Bacillus subtilis phage SPbetaB]";
RL   Mol. Gen. Mikrobiol. Virusol. 1985:26-28(1985).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   not original sequence.
CC   NM (pSK15)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pUC18)(lambda)
CC   BR (pSK16)
CC   OF (pSK28)(pSK30 from pSK28)
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC18 HincII 2686bp 420..420
FT                   2. lambda FokI-HinfI 29bp 1666..1695
FT                   \ FokI-MspI/HpaII sites [23bp]
FT                   Klenow:Klenow
FT                   oligo 23bp taacgcccggcttcatccggatt
FT                   -> pSK15 2709bp [unique BspMI, MspI-FokI]"
FT   -               1..419
FT                   /note="pUC18 1..419 419bp
FT                   HindII = HincII = GTY^RAC
FT                   FokI = GGATG(9/13)
FT                   \                     taacgcccggcttcatccggatt"
FT   -               420..442
FT                   /note="taacgcccggcttcatccggatt 23bp
FT                   \ taacgcccggcttcatccggatt
FT                   HinfI =             G^ANTC
FT                   HindII = HincII =     GTY^RAC"
FT   -               443..2709
FT                   /note="pUC18 420..2686 2267bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 2709 BP; 672 A; 685 C; 688 G; 664 T; 0 other;
     tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
     accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc
     attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat
     tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt
     tttcccagtc acgacgttgt aaaacgacgg ccagtgccaa gcttgcatgc ctgcaggtct
     aacgcccggc ttcatccgga ttgactctag aggatccccg ggtaccgagc tcgaattcgt
     aatcatggtc atagctgttt cctgtgtgaa attgttatcc gctcacaatt ccacacaaca
     tacgagccgg aagcataaag tgtaaagcct ggggtgccta atgagtgagc taactcacat
     taattgcgtt gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc cagctgcatt
     aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct tccgcttcct
     cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa
     aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa
     aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc
     tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga
     caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc
     cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt
     ctcaaagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct
     gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg
     agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta
     gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct
     acactagaag aacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa
     gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt
     gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta
     cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat
     caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa
     gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct
     cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta
     cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct
     caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg
     gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa
     gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt
     cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta
     catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca
     gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta
     ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct
     gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg
     cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac
     tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact
     gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa
     atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt
     ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat
     gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg
     acgtctaaga aaccattatt atcatgacat taacctataa aaataggcgt atcacgaggc
     cctttcgtc
//