back Return to this vector's summary.
ID   PSK16      preliminary; circular DNA; SYN; 7272 BP.
XX
AC   IG5055; S38358;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pSK16 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pSK15 from pUC18 & lambda
RC   pSK16 from M13mp18 & lambda
RC   pSK28 from pSK15 & pSU11, bsuRIM gene
RC   pSK30 from pSK28 & pES2
RA   Kim S., Posfai G., Szybalski W.;
RT   "A novel gene-fusing vector: construction of a 5'-GGmCC-specific
RT   chimeric methyltransferase, M.BspRI/M.BsuRI";
RL   Gene 100:45-50(1991).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   not original sequence.
CC   NM (pSK16)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (M13mp18)(lambda)
CC   BR (pSK15)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. M13mp18 HincII 7249bp 6266..6266
FT                   2. lambda FokI-HinfI 23bp, MspI/HpaII-FokI site
FT                   \ complement
FT                   Klenow:Klenow
FT                   oligo 23bp taacgcccggcttcatccggatt
FT                   -> pSK16 7272bp [unique BspMI, MspI-FokI]"
FT   -               1..6265
FT                   /note="M13mp18 1..6265 6265bp
FT                   HindII = HincII = GTY^RAC
FT                   FokI = GGATG(9/13)
FT                   \                     taacgcccggcttcatccggatt"
FT   -               6266..6288
FT                   /note="taacgcccggcttcatccggatt 23bp
FT                   \ taacgcccggcttcatccggatt
FT                   HinfI =             G^ANT C
FT                   HindII = HincII =     GTY^RAC"
FT   -               6289..7272
FT                   /note="M13mp18 6266..7249 984bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 7272 BP; 1772 A; 1546 C; 1538 G; 2416 T; 0 other;
     aatgctacta ctattagtag aattgatgcc accttttcag ctcgcgcccc aaatgaaaat
     atagctaaac aggttattga ccatttgcga aatgtatcta atggtcaaac taaatctact
     cgttcgcaga attgggaatc aactgttaca tggaatgaaa cttccagaca ccgtacttta
     gttgcatatt taaaacatgt tgagctacag caccagattc agcaattaag ctctaagcca
     tccgcaaaaa tgacctctta tcaaaaggag caattaaagg tactctctaa tcctgacctg
     ttggagtttg cttccggtct ggttcgcttt gaagctcgaa ttaaaacgcg atatttgaag
     tctttcgggc ttcctcttaa tctttttgat gcaatccgct ttgcttctga ctataatagt
     cagggtaaag acctgatttt tgatttatgg tcattctcgt tttctgaact gtttaaagca
     tttgaggggg attcaatgaa tatttatgac gattccgcag tattggacgc tatccagtct
     aaacatttta ctattacccc ctctggcaaa acttcttttg caaaagcctc tcgctatttt
     ggtttttatc gtcgtctggt aaacgagggt tatgatagtg ttgctcttac tatgcctcgt
     aattcctttt ggcgttatgt atctgcatta gttgaatgtg gtattcctaa atctcaactg
     atgaatcttt ctacctgtaa taatgttgtt ccgttagttc gttttattaa cgtagatttt
     tcttcccaac gtcctgactg gtataatgag ccagttctta aaatcgcata aggtaattca
     caatgattaa agttgaaatt aaaccatctc aagcccaatt tactactcgt tctggtgttc
     tcgtcagggc aagccttatt cactgaatga gcagctttgt tacgttgatt tgggtaatga
     atatccggtt cttgtcaaga ttactcttga tgaaggtcag ccagcctatg cgcctggtct
     gtacaccgtt catctgtcct ctttcaaagt tggtcagttc ggttccctta tgattgaccg
     tctgcgcctc gttccggcta agtaacatgg agcaggtcgc ggatttcgac acaatttatc
     aggcgatgat acaaatctcc gttgtacttt gtttcgcgct tggtataatc gctgggggtc
     aaagatgagt gttttagtgt attctttcgc ctctttcgtt ttaggttggt gccttcgtag
     tggcattacg tattttaccc gtttaatgga aacttcctca tgaaaaagtc tttagtcctc
     aaagcctctg tagccgttgc taccctcgtt ccgatgctgt ctttcgctgc tgagggtgac
     gatcccgcaa aagcggcctt taactccctg caagcctcag cgaccgaata tatcggttat
     gcgtgggcga tggttgttgt cattgtcggc gcaactatcg gtatcaagct gtttaagaaa
     ttcacctcga aagcaagctg ataaaccgat acaattaaag gctccttttg gagccttttt
     ttttggagat tttcaacgtg aaaaaattat tattcgcaat tcctttagtt gttcctttct
     attctcactc cgctgaaact gttgaaagtt gtttagcaaa accccataca gaaaattcat
     ttactaacgt ctggaaagac gacaaaactt tagatcgtta cgctaactat gagggttgtc
     tgtggaatgc tacaggcgtt gtagtttgta ctggtgacga aactcagtgt tacggtacat
     gggttcctat tgggcttgct atccctgaaa atgagggtgg tggctctgag ggtggcggtt
     ctgagggtgg cggttctgag ggtggcggta ctaaacctcc tgagtacggt gatacaccta
     ttccgggcta tacttatatc aaccctctcg acggcactta tccgcctggt actgagcaaa
     accccgctaa tcctaatcct tctcttgagg agtctcagcc tcttaatact ttcatgtttc
     agaataatag gttccgaaat aggcaggggg cattaactgt ttatacgggc actgttactc
     aaggcactga ccccgttaaa acttattacc agtacactcc tgtatcatca aaagccatgt
     atgacgctta ctggaacggt aaattcagag actgcgcttt ccattctggc tttaatgaag
     atccattcgt ttgtgaatat caaggccaat cgtctgacct gcctcaacct cctgtcaatg
     ctggcggcgg ctctggtggt ggttctggtg gcggctctga gggtggtggc tctgagggtg
     gcggttctga gggtggcggc tctgagggag gcggttccgg tggtggctct ggttccggtg
     attttgatta tgaaaagatg gcaaacgcta ataagggggc tatgaccgaa aatgccgatg
     aaaacgcgct acagtctgac gctaaaggca aacttgattc tgtcgctact gattacggtg
     ctgctatcga tggtttcatt ggtgacgttt ccggccttgc taatggtaat ggtgctactg
     gtgattttgc tggctctaat tcccaaatgg ctcaagtcgg tgacggtgat aattcacctt
     taatgaataa tttccgtcaa tatttacctt ccctccctca atcggttgaa tgtcgccctt
     ttgtctttag cgctggtaaa ccatatgaat tttctattga ttgtgacaaa ataaacttat
     tccgtggtgt ctttgcgttt cttttatatg ttgccacctt tatgtatgta ttttctacgt
     ttgctaacat actgcgtaat aaggagtctt aatcatgcca gttcttttgg gtattccgtt
     attattgcgt ttcctcggtt tccttctggt aactttgttc ggctatctgc ttacttttct
     taaaaagggc ttcggtaaga tagctattgc tatttcattg tttcttgctc ttattattgg
     gcttaactca attcttgtgg gttatctctc tgatattagc gctcaattac cctctgactt
     tgttcagggt gttcagttaa ttctcccgtc taatgcgctt ccctgttttt atgttattct
     ctctgtaaag gctgctattt tcatttttga cgttaaacaa aaaatcgttt cttatttgga
     ttgggataaa taatatggct gtttattttg taactggcaa attaggctct ggaaagacgc
     tcgttagcgt tggtaagatt caggataaaa ttgtagctgg gtgcaaaata gcaactaatc
     ttgatttaag gcttcaaaac ctcccgcaag tcgggaggtt cgctaaaacg cctcgcgttc
     ttagaatacc ggataagcct tctatatctg atttgcttgc tattgggcgc ggtaatgatt
     cctacgatga aaataaaaac ggcttgcttg ttctcgatga gtgcggtact tggtttaata
     cccgttcttg gaatgataag gaaagacagc cgattattga ttggtttcta catgctcgta
     aattaggatg ggatattatt tttcttgttc aggacttatc tattgttgat aaacaggcgc
     gttctgcatt agctgaacat gttgtttatt gtcgtcgtct ggacagaatt actttacctt
     ttgtcggtac tttatattct cttattactg gctcgaaaat gcctctgcct aaattacatg
     ttggcgttgt taaatatggc gattctcaat taagccctac tgttgagcgt tggctttata
     ctggtaagaa tttgtataac gcatatgata ctaaacaggc tttttctagt aattatgatt
     ccggtgttta ttcttattta acgccttatt tatcacacgg tcggtatttc aaaccattaa
     atttaggtca gaagatgaaa ttaactaaaa tatatttgaa aaagttttct cgcgttcttt
     gtcttgcgat tggatttgca tcagcattta catatagtta tataacccaa cctaagccgg
     aggttaaaaa ggtagtctct cagacctatg attttgataa attcactatt gactcttctc
     agcgtcttaa tctaagctat cgctatgttt tcaaggattc taagggaaaa ttaattaata
     gcgacgattt acagaagcaa ggttattcac tcacatatat tgatttatgt actgtttcca
     ttaaaaaagg taattcaaat gaaattgtta aatgtaatta attttgtttt cttgatgttt
     gtttcatcat cttcttttgc tcaggtaatt gaaatgaata attcgcctct gcgcgatttt
     gtaacttggt attcaaagca atcaggcgaa tccgttattg tttctcccga tgtaaaaggt
     actgttactg tatattcatc tgacgttaaa cctgaaaatc tacgcaattt ctttatttct
     gttttacgtg ctaataattt tgatatggtt ggttcaattc cttccataat tcagaagtat
     aatccaaaca atcaggatta tattgatgaa ttgccatcat ctgataatca ggaatatgat
     gataattccg ctccttctgg tggtttcttt gttccgcaaa atgataatgt tactcaaact
     tttaaaatta ataacgttcg ggcaaaggat ttaatacgag ttgtcgaatt gtttgtaaag
     tctaatactt ctaaatcctc aaatgtatta tctattgacg gctctaatct attagttgtt
     agtgcaccta aagatatttt agataacctt cctcaattcc tttctactgt tgatttgcca
     actgaccaga tattgattga gggtttgata tttgaggttc agcaaggtga tgctttagat
     ttttcatttg ctgctggctc tcagcgtggc actgttgcag gcggtgttaa tactgaccgc
     ctcacctctg ttttatcttc tgctggtggt tcgttcggta tttttaatgg cgatgtttta
     gggctatcag ttcgcgcatt aaagactaat agccattcaa aaatattgtc tgtgccacgt
     attcttacgc tttcaggtca gaagggttct atctctgttg gccagaatgt cccttttatt
     actggtcgtg tgactggtga atctgccaat gtaaataatc catttcagac gattgagcgt
     caaaatgtag gtatttccat gagcgttttt cctgttgcaa tggctggcgg taatattgtt
     ctggatatta ccagcaaggc cgatagtttg agttcttcta ctcaggcaag tgatgttatt
     actaatcaaa gaagtattgc tacaacggtt aatttgcgtg atggacagac tcttttactc
     ggtggcctca ctgattataa aaacacttct caagattctg gcgtaccgtt cctgtctaaa
     atccctttaa tcggcctcct gtttagctcc cgctctgatt ccaacgagga aagcacgtta
     tacgtgctcg tcaaagcaac catagtacgc gccctgtagc ggcgcattaa gcgcggcggg
     tgtggtggtt acgcgcagcg tgaccgctac acttgccagc gccctagcgc ccgctccttt
     cgctttcttc ccttcctttc tcgccacgtt cgccggcttt ccccgtcaag ctctaaatcg
     ggggctccct ttagggttcc gatttagtgc tttacggcac ctcgacccca aaaaacttga
     tttgggtgat ggttcacgta gtgggccatc gccctgatag acggtttttc gccctttgac
     gttggagtcc acgttcttta atagtggact cttgttccaa actggaacaa cactcaaccc
     tatctcgggc tattcttttg atttataagg gattttgccg atttcggaac caccatcaaa
     caggattttc gcctgctggg gcaaaccagc gtggaccgct tgctgcaact ctctcagggc
     caggcggtga agggcaatca gctgttgccc gtctcgctgg tgaaaagaaa aaccaccctg
     gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca
     cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttagct
     cactcattag gcaccccagg ctttacactt tatgcttccg gctcgtatgt tgtgtggaat
     tgtgagcgga taacaatttc acacaggaaa cagctatgac catgattacg aattcgagct
     cggtacccgg ggatcctcta gagtctaacg cccggcttca tccggattga cctgcaggca
     tgcaagcttg gcactggccg tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac
     ccaacttaat cgccttgcag cacatccccc tttcgccagc tggcgtaata gcgaagaggc
     ccgcaccgat cgcccttccc aacagttgcg cagcctgaat ggcgaatggc gctttgcctg
     gtttccggca ccagaagcgg tgccggaaag ctggctggag tgcgatcttc ctgaggccga
     tacggtcgtc gtcccctcaa actggcagat gcacggttac gatgcgccca tctacaccaa
     cgtaacctat cccattacgg tcaatccgcc gtttgttccc acggagaatc cgacgggttg
     ttactcgctc acatttaatg ttgatgaaag ctggctacag gaaggccaga cgcgaattat
     ttttgatggc gttcctattg gttaaaaaat gagctgattt aacaaaaatt taacgcgaat
     tttaacaaaa tattaacgtt tacaatttaa atatttgctt atacaatctt cctgtttttg
     gggcttttct gattatcaac cggggtacat atgattgaca tgctagtttt acgattaccg
     ttcatcgatt ctcttgtttg ctccagactc tcaggcaatg acctgatagc ctttgtagat
     ctctcaaaaa tagctaccct ctccggcatt aatttatcag ctagaacggt tgaatatcat
     attgatggtg atttgactgt ctccggcctt tctcaccctt ttgaatcttt acctacacat
     tactcaggca ttgcatttaa aatatatgag ggttctaaaa atttttatcc ttgcgttgaa
     ataaaggctt ctcccgcaaa agtattacag ggtcataatg tttttggtac aaccgattta
     gctttatgct ctgaggcttt attgcttaat tttgctaatt ctttgccttg cctgtatgat
     ttattggatg tt
//