back Return to this vector's summary.
ID   PSK241     preliminary; circular DNA; SYN; 3830 BP.
XX
AC   IG5024;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli phagemid vector pSK241 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pSK222 from pKK223-3 & pGEM-5Zf-
RC   pSK241 from pSK222
RA   Kunapuli S.P., Colman R.W.;
RT   "Two new phagemid vectors for site-directed mutagenesis and
RT   expression in E. coli";
RL   Biotechniques 14:332-338(1993).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pSK241)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (phagemid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pSK222 from pKK223-3 and pGEM5Zf-)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pGEM-5Zf- SfaNI-SfaNI 733bp 2368..3003..98,
FT                   \ phage f1 ori
FT                   \ SfaNI = 98 600 1652 1843 2092 2328 2368
FT                   Klenow:
FT                   :SphI linker
FT                   2. pKK223-3 PvuII-SphI 3084bp 1948..4584..448
FT                   -> pSK222 3817bp
FT                   1. pSK222 remove PstI-EcoRI 18bp 4565..4583, 3799bp
FT                   \ pGEM5Zf- PstI 74
FT                   2. oligo 38bp aattcgagctcgagggtacccgggacatctagactgca
FT                   -> pSK241 3837bp"
FT   -               1..2617
FT                   /note="pKK223-3 1948..4564 2617bp
FT                   PstI = CTGCA^G
FT                   \            gtcta..."
FT   -               2618..2647
FT                   /note="gtctagatgtcccgggtaccctcgagctcg 30bp
FT                   \ ...gctcg
FT                   EcoRI =  G^AATTC"
FT   -               2648..3096
FT                   /note="pKK223-3 4583..4584..447 449bp
FT                   SphI = GCATG^C
FT                   \            c"
FT   -               3097..3097
FT                   /note="c 1bp
FT                   \                     c
FT                   SphI =          GCATG^C
FT                   SfaNI = GCATC(5/9)aggcg
FT                   \                       acgc..."
FT   -               3098..3830
FT                   /note="pGEM-5Zf- 2368..3003..97 733bp
FT                   \     ctccc
FT                   SfaNI =     aacgcgttggatgc
FT                   SfaNI =              GCATC(5/9)
FT                   PvuII = CAG^CTG"
FT   misc_binding    0..0
FT                   /note="SIT BamHI"
FT   promoter        0..0
FT                   /note="PRO E. coli tac"
FT   misc_binding    1..38
FT                   /note="MCS unique EcoRI-XhoI-SacI-KpnI-SmaI-BglII-
FT                   XbaI-PstI-HindIII"
FT   misc_binding    0..0
FT                   /note="SIT XmnI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   rep_origin      0..0
FT                   /note="ORI phage f1"
XX
SQ   Sequence 3830 BP; 891 A; 1011 C; 975 G; 953 T; 0 other;
     ctgcctcgcg cgtttcggtg atgacggtga aaacctctga cacatgcagc tcccggagac
     ggtcacagct tgtctgtaag cggatgccgg gagcagacaa gcccgtcagg gcgcgtcagc
     gggtgttggc gggtgtcggg gcgcagccat gacccagtca cgtagcgata gcggagtgta
     tactggctta actatgcggc atcagagcag attgtactga gagtgcacca tatgcggtgt
     gaaataccgc acagatgcgt aaggagaaaa taccgcatca ggcgctcttc cgcttcctcg
     ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag
     gcggtaatac ggttatccac agaatcaggg gataacgcag gaaagaacat gtgagcaaaa
     ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc
     cgcccccctg acgagcatca caaaaatcga cgctcaagtc agaggtggcg aaacccgaca
     ggactataaa gataccaggc gtttccccct ggaagctccc tcgtgcgctc tcctgttccg
     accctgccgc ttaccggata cctgtccgcc tttctccctt cgggaagcgt ggcgctttct
     caatgctcac gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt
     gtgcacgaac cccccgttca gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag
     tccaacccgg taagacacga cttatcgcca ctggcagcag ccactggtaa caggattagc
     agagcgaggt atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa ctacggctac
     actagaagga cagtatttgg tatctgcgct ctgctgaagc cagttacctt cggaaaaaga
     gttggtagct cttgatccgg caaacaaacc accgctggta gcggtggttt ttttgtttgc
     aagcagcaga ttacgcgcag aaaaaaagga tctcaagaag atcctttgat cttttctacg
     gggtctgacg ctcagtggaa cgaaaactca cgttaaggga ttttggtcat gagattatca
     aaaaggatct tcacctagat ccttttaaat taaaaatgaa gttttaaatc aatctaaagt
     atatatgagt aaacttggtc tgacagttac caatgcttaa tcagtgaggc acctatctca
     gcgatctgtc tatttcgttc atccatagtt gcctgactcc ccgtcgtgta gataactacg
     atacgggagg gcttaccatc tggccccagt gctgcaatga taccgcgaga cccacgctca
     ccggctccag atttatcagc aataaaccag ccagccggaa gggccgagcg cagaagtggt
     cctgcaactt tatccgcctc catccagtct attaattgtt gccgggaagc tagagtaagt
     agttcgccag ttaatagttt gcgcaacgtt gttgccattg ctacagcatc gtggtgtcac
     gctcgtcgtt tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat
     gatcccccat gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa
     gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg
     tcatgccatc cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag
     aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aacacgggat aataccgcgc
     cacatagcag aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct
     caaggatctt accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat
     cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg
     ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc
     aatattattg aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta
     tttagaaaaa taaacaaaag agtttgtaga aacgcaaaaa ggccatccgt caggatggcc
     ttctgcttaa tttgatgcct ggcagtttat ggcgggcgtc ctgcccgcca ccctccgggc
     cgttgcttcg caacgttcaa atccgctccc ggcggatttg tcctactcag gagagcgttc
     accgacaaac aacagataaa acgaaaggcc cagtctttcg actgagcctt tcgttttatt
     tgatgcctgg cagttcccta ctctcgcatg gggagacccc acactaccat cggcgctacg
     gcgtttcact tctgagttcg gcatggggtc aggtgggacc accgcgctac tgccgccagg
     caaattctgt tttatcagac cgcttctgcg ttctgattta atctgtatca ggctgaaaat
     cttctctcat ccgccaaaac agccaagctt ggctgcagtc tagatgtccc gggtaccctc
     gagctcgaat tctgtttcct gtgtgaaatt gttatccgct cacaattcca cacattatac
     gagccgatga ttaattgtca acagctcatt tcagaatatt tgccagaacc gttatgatgt
     cggcgcaaaa aacattatcc agaacgggag tgcgccttga gcgacacgaa ttatgcagtg
     atttacgacc tgcacagcca taccacagct tccgatggct gcctgacgcc agaagcattg
     gtgcaccgtg cagtcgataa gcccggatcc tctacgccgg acgcatcgtg gccggcatca
     ccggcgccac aggtgcggtt gctggcgcct atatcgccga catcaccgat ggggaagatc
     gggctcgcca cttcgggctc atgagcgctt gtttcggcgt gggtatggtg gcaggccccg
     tggccggggg actgttgggc gccatctcct tgcatgcacg cgccctgtag cggcgcatta
     agcgcggcgg gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag cgccctagcg
     cccgctcctt tcgctttctt cccttccttt ctcgccacgt tcgccggctt tccccgtcaa
     gctctaaatc gggggctccc tttagggttc cgatttagag ctttacggca cctcgaccgc
     aaaaaacttg atttgggtga tggttcacgt agtgggccat cgccctgata gacggttttt
     cgccctttga cgttggagtc cacgttcttt aatagtggac tcttgttcca aactggaaca
     acactcaacc ctatctcggt ctattctttt gatttataag ggattttgcc gatttcggcc
     tattggttaa aaaatgagct gatttaacaa atatttaacg cgaattttaa caaaatatta
     acgtttacaa tttccattcg ccattcaggc tgcgcaactg ttgggaaggg cgatcggtgc
     gggcctcttc gctattacgc cagctggcga aagggggatg tgctgcaagg cgattaagtt
     gggtaacgcc agggttttcc cagtcacgac gttgtaaaac gacggccagt gaattgtaat
     acgactcact atagggcgaa ttgggcccga cgtcgcatgc tcccggccgc catggccgcg
     ggatatcact agtgcggccg cctgcaggtc gaccatatgg gagagctccc
//