back Return to this vector's summary.
ID   PSP189     preliminary; circular DNA; SYN; 4952 BP.
XX
AC   U14594; IG5073;
XX
DT   28-SEP-1994 (Rel. 10, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pSP189 - complete.
XX
KW   cloning vector; shuttle vector; signature sequence.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   27-111
RC   pSP189 from pMS189 & pBR327 & supF tRNA
RA   Parris C.N., Seidman M.M.;
RT   "A signature element distinguishes sibling and independent mutations
RT   in a shuttle vector plasmid";
RL   Gene 117:1-5(1992).
XX
RN   [2]
RC   from pSP189
RA   Parris C.N., Levy D.D., Jessee J., Seidman M.M.;
RT   "Proximal and distal effects of sequence context on ultraviolet
RT   mutational hotspots in a shuttle vector replicated in xeroderma
RT   cells";
RL   J. Mol. Biol. 236:491-502(1994).
XX
RN   [3]
RP   1-270
RC   pSP189 from pMS189 & pBR327 & supF tRNA
RA   Levy D.D.;
RT   ;
RL   Unpublished (1994).
XX
RN   [4]
RP   1-4952
RC   pSP189
RA   Levy D.D.;
RT   ;
RL   Submitted (09-SEP-1994) by:
RL   Levy D.D., National Cancer Institute, National Institutes of Health,
RL   Laboratory of Molecular Carcinogenesis, Bethesda, MD 20892, USA.
XX
RN   [5]
RC   from pZ189
RC   pMS189 from pBR327 & SV40 early region ori/T-antigen & supF gene
RC   pMS981 from pBR327 & SV40 early region ori/T-antigen & supF gene
RC   from pMS189
RC   from pMS981
RA   Seetharam S., Seidman M.M.;
RT   "Modulation of an ultraviolet mutational hotspot in a shuttle
RT   vector in xeroderma cells";
RL   Nucleic Acids Res. 19:1601-1604(1991).
XX
CC   NCBI gi: 550455
CC   NM (pSP189)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pZ189, ori/amp/SV40 early/ori/t
FT                   \ SV40 3056bp 2534..5243..347
FT                   2. E. coli, supF gene
FT                   -> pMS189
FT                   1. E. coli 84bp,
FT                   \ ccaccccaagggctcgccggtttccctcgtctgagatttagacggc
FT                   \ agtagctgaagcttccaagcttaggaagggggtggtggtggtgggg
FT                   \ ttcccgagcggccaaagggagcagactctaaatctgccgtcatcga
FT                   \ cttcgaaggttcgaatccttcccccaccacca, supF tRNA
FT                   2. terminator 44bp
FT                   3. 8-bp signature sequence 28bp
FT                   \ gcgcgagctcgactgactccnnnnnnnngagctcgcgc
FT                   -> supF tRNA cassette 156bp
FT                   1. pMS189
FT                   2. pBR327 EcoRI 3273bp 3272..3272, 41 bp 3' to amp
FT                   3. supF tRNA cassette 156bp
FT                   -> pSP189 4952bp"
FT   tRNA            27..111
FT                   /note="amber codon-tyrosine suppressor SupF. [1]
FT                   5' end of mature tRNA (plasmid position 27) is
FT                   position 99 in the traditional tRNA nomenclature.
FT                   bp 1-98, the pre-tRNA region, have been deleted.
FT                   Promoter is a cryptic promoter in b-lactamase gene.
FT                   codon recognized: TAG; aa: Tyrosine"
FT   misc_feature    183..190
FT                   /note="DO NOT CLONE THIS PLASMID.
FT                   Cloning eliminates the
FT                   sequence variation in the plasmid population.
FT                   Vector is for determination of independence of
FT                   mutations [1] [2]"
FT   rep_origin      927..3985
FT                   /note="ORI SV40 (SV40cg.gb_vi) replication origin
FT                   and t and T antigens. SV40 2533 (BamHI) to 346 (MspI)"
FT   CDS             complement(4054..4914)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amr); from
FT                   pBR327 2149 (DraI) to 3274 (EcoRI)"
XX
SQ   Sequence 4952 BP; 1343 A; 1175 C; 974 G; 1452 T; 8 other;
     gaattcgaga gccctgctcg agctgtggtg gggttcccga gcggccaaag ggagcagact
     ctaaatctgc cgtcatcgac ttcgaaggtt cgaatccttc ccccaccacc acggccgaaa
     ttcggtaccc ggatccttag cgaaagctaa gatttttttt acgcgtgagc tcgactgact
     ccnnnnnnnn gagctcaatt cggtcgaggt cgggccgcgt tgctggcgtt tttccatagg
     ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg
     acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt
     ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt
     tctcatagct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc
     tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt
     gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt
     agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc
     tacactagaa ggacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa
     agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt
     tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct
     acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta
     tcaaaaagga tcttcaccta gatccagatc cagacatgat aagatacatt gatgagtttg
     gacaaaccac aactagaatg cagtgaaaaa aatgctttat ttgtgaaatt tgtgatgcta
     ttgctttatt tgtaaccatt ataagctgca ataaacaagt taacaacaac aattgcattc
     attttatgtt tcaggttcag ggggaggtgt gggaggtttt ttaaagcaag taaaacctct
     acaaatgtgg tatggctgat tatgatcatg aacagactgt gaggactgag gggcctgaaa
     tgagccttgg gactgtgaat caatgcctgt ttcatgccct gagtcttcca tgttcttctc
     cccaccatct tcatttttat cagcattttc ctggctgtct tcatcatcat catcactgtt
     tcttagccaa tctaaaactc caattcccat agccacatta aacttcattt tttgatacac
     tgacaaacta aactctttgt ccaatctctc tttccactcc acaattctgc tctgaatact
     ttgagcaaac tcagccacag gtctgtacca aattaacata agaagcaaag caatgccact
     ttgaattatt ctcttttcta acaaaaactc actgcgttcc aggcaatgct ttaaataatc
     tttgggccta aaatctattt gttttacaaa tctggcctgc agtgttttag gcacactgta
     ctcattcatg gtgactattc cagggggaaa tatttgagtt cttttattta ggtgtttctt
     ttctaagttt accttaacac tgccatccaa ataatccctt aaattgtcca ggttattaat
     tccctgacct gaaggcaaat ctctggactc ccctccagtg ccctttacat cctcaaaaac
     tactaaaaac tggtcaatag ctactcctag ctcaaagttc agcctgtcca agggcaaatt
     aacatttaaa gctttccccc cacataattc aagcaaagca gctgctaatg tagttttacc
     actatcaatt ggtcctttaa acagccagta tcttttttta ggaatgttgt acaccatgca
     ttttaaaaag tcatacacca ctgaatccat tttgggcaac aaacagtgta gccaagcaac
     tccagccatc cattcttcta tgtcagcaga gcctgtagaa ccaaacatta tatccatcct
     atccaaaaga tcattaaatc tgtttgttaa catttgttct ctagttaatt gtaggctatc
     aacccgcttt ttagctaaaa cagtatcaac agcctgttgg catatggttt tttggttttt
     gctgtcagca aatatagcag catttgcata atgcttttca tggtacttat agtggctggg
     ctgttctttt ttaatacatt ttaaacacat ttcaaaactg tactgaaatt ccaagtacat
     cccaagcaat aacaacacat catcacattt tgtttccatt gcatactctg ttacaagctt
     ccaggacact tgtttagttt cctctgcttc ttctggatta aaatcatgct cctttaaccc
     acctggcaaa ctttcctcaa taacagaaaa tggatctcta gtcaaggcac tatacatcaa
     atattcctta ttaacccctt tacaaattaa aaagctaaag gtacacaatt tttgagcata
     gttattaata gcagacactc tatgcctgtg tggagtaaga aaaaacagta tgttatgatt
     ataactgtta tgcctactta taaaggttac agaatatttt tccataattt tcttgtatag
     cagtgcagct ttttcctttg tggtgtaaat agcaaagcaa gcaagagttc tattactaaa
     cacagcatga ctcaaaaaac ttagcaattc tgaaggaaag tccttggggt cttctacctt
     tctcttcttt tttggaggag tagaatgttg agagtcagca gtagcctcat catcactaga
     tggcatttct tctgagcaaa acaggttttc ctcattaaag gcattccacc actgctccca
     ttcatcagtt ccataggttg gaatctaaaa tacacaaaca attagaatca gtagtttaac
     acattataca cttaaaaatt ttatatttac cttagagctt taaatctctg taggtagttt
     gtccaattat gtcacaccac agaagtaagg ttccttcaca aagatcaagt ccaaaccaca
     ttctaaagca atcgaagcag tagcaatcaa cccacacaag tggatctttc ctgtataatt
     ttctattttc atgcttcatc ctcagtaagc acagcaagca tatgcagtta gcagacattt
     tctttgcaca ctcaggccat tgtttgcagt acattgcatc aacaccagga tttaaggaag
     aagcaaatac ctcagttgca tcccagaagc ctccaaagtc aggttgatga gcatatttta
     ctccatcttc cattttcttg tacagagtat tcattttctt cattttttct tcatctcctc
     ctttatcagg atgaaactcc ttgcattttt ttaaatatgc ctttctcatc agaggaatat
     tcccccaggc actcctttca agacctagaa ggtccattag ctgcaaagat tcctctctgt
     ttaaaacttt atccatcttt gcaaagcttt ttgcaaaagc ctaggcctcc aaaaaagcct
     cctcactact tctggaatag ctcagaggcc gaggcggcct cggcctctgc ataaataaaa
     aaaattagtc agccatgggg cggagaatgg gcggaactgg gcggagttag gggcgggatg
     ggcggagtta ggggcgggac tatggttgct gactaattga gatgcatgct ttgcatactt
     ctgcctgctg gggagcctgg ggactttcca cacctggttg ctgactaatt gagatgcatg
     ctttgcatac ttctgcctgc tggggagcct ggggactttc cacaccctaa ctgacacaca
     ttccacagct ggttctttcc gcctcagaag gtacctaacc aagttcctct ttcagaggtt
     atttcaggcc atggtgctgc gccgggatct tttaaattaa aaatgaagtt ttaaatcaat
     ctaaagtata tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc
     tatctcagcg atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat
     aactacgata cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc
     acgctcaccg gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag
     aagtggtcct gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag
     agtaagtagt tcgccagtta atagtttgcg caacgttgtt gccattgctg caggcatcgt
     ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg
     agttacatga tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt
     tgtcagaagt aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc
     tcttactgtc atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc
     attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa cacgggataa
     taccgcgcca catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg
     aaaactctca aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc
     caactgatct tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag
     gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt
     cctttttcaa tattattgaa gcatttatca gg
//