back Return to this vector's summary.
ID   PSP44      preliminary; circular DNA; SYN; 6092 BP.
XX
AC   M38660;
XX
DT   20-SEP-1990 (Rel. 5, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pSP44 - complete, synthetic protein gene.
XX
KW   cloning vector; synthetic protein.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-96
RC   pSP44, pSP47 from pBR325 & synthetic polypeptide
RA   Jaynes J.M., Langridge P., Anderson K., Bond C., Sands D.,
RA   Newman C.W., Newman R.;
RT   "Construction and expression of synthetic DNA fragments coding for
RT   polypeptides with elevated levels of essential amino acids";
RL   Appl. Microbiol. Biotechnol. 21:200-205(1985).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   pSP47 has size 6300 bp.
CC   NCBI gi: 207834
CC   NM (pSP44)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)(expression)
CC   SE ()
CC   PA (pBR325)
CC   BR (pSP47)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR325 EcoRI 5996bp 4780..4780
FT                   2. SP44 oligo EcoRI-EcoRI 96bp
FT                   \ aattcgggacgatcacgatccatccatttcttaagaaatggatgacgatc
FT                   \ catccatttcttaagaaatggatgacgatccatccatttcttcccg
FT                   -> pSP44 6094bp"
FT   -               1..4779
FT                   /note="pBR325 1..4779 4779bp
FT                   EcoRI = G^AATTC"
FT   -               4780..4875
FT                   /note="96bp
FT                   \ aattcgggacgatcacgatccatccatttcttaagaaatggatgacgatc
FT                   \ catccatttcttaagaaatggatgacgatccatccatttcttcccg
FT                   EcoRI = G^AATTC"
FT   -               4876..6092
FT                   /note="pBR325 4780..5996 1217bp"
FT   misc_feature    0..0
FT                   /note="SP44 oligonucleotide inserted into EcoRI site
FT                   of pBR325;
FT                   for pSP47, SP47 oligo inserted into EcoRI site:
FT                   aattcgggga tcgtaagaaa tggatggatc gtcatccatt tcttcatcca
FT                   tttcttacga tccatccatt tcttaagaaa tggatgaaga aatggatgac
FT                   gatccatcca tttcttcatc catttcttca tccatttctt acgatcaaga
FT                   aatggatgaa gaaatggatg aagaaatgga tgaagaaatg gatgcatcca
FT                   tttcttaaga aatggatgaa gaaatggatg aagaaatgga tgacgatcga
FT                   tcgtaagaaa tggatgacga tccatccatt tcttacgatc cccg"
FT   CDS             <1..>96
FT                   /note="GEN synthetic protein gene;
FT                   NCBI gi: 207835"
XX
SQ   Sequence 6092 BP; 1423 A; 1624 C; 1581 G; 1464 T; 0 other;
     aggccatgtt tgacagctta tcatcgataa gctttaatgc ggtagtttat cacagttaaa
     ttgctaacgc agtcaggcac cgtgtatgaa atctaacaat gcgctcatcg tcatcctcgg
     caccgtcacc ctggatgctg taggcatagg cttggttatg ccggtactgc cgggcctctt
     gcgggatatc gtccattccg acagcatcgc cagtcactat ggcgtgctgc tagcgctata
     tgcgttgatg caatttctat gcgcacccgt tctcggagca ctgtccgacc gctttggccg
     ccgcccagtc ctgctcgctt cgctacttgg agccactatc gactacgcga tcatggcgac
     cacacccgtc ctgtggatcc tctacgccgg acgcatcgtg gccggcatca ccggcgccac
     aggtgcggtt gctggcgcct atatcgccga catcaccgat ggggaagatc gggctcgcca
     cttcgggctc atgagcgctt gtttcggcgt gggtatggtg gcaggccccg tggccggggg
     actgttgggc gccatctcct tgcatgcacc attccttgcg gcggcggtgc tcaacggcct
     caacctacta ctgggctgct tcctaatgca ggagtcgcat aagggagagc gtcgaccgat
     gcccttgaga gccttcaacc cagtcagctc cttccggtgg gcgcggggca tgactatcgt
     cgccgcactt atgactgtct tctttatcat gcaactcgta ggacaggtgc cggcagcgct
     ctgggtcatt ttcggcgagg accgctttcg ctggagcgcg acgatgatcg gcctgtcgct
     tgcggtattc ggaatcttgc acgccctcgc tcaagccttc gtcactggtc ccgccaccaa
     acgtttcggc gagaagcagg ccattatcgc cggcatggcg gccgacgcgc tgggctacgt
     cttgctggcg ttcgcgacgc gaggctggat ggccttcccc attatgattc ttctcgcttc
     cggcggcatc gggatgcccg cgttgcaggc catgctgtcc aggcaggtag atgacgacca
     tcagggacag cttcaaggat cgctcgcggc tcttaccagc ctaacttcga tcactggacc
     gctgatcgtc acggcgattt atgccgcctc ggcgagcaca tggaacgggt tggcatggat
     tgtaggcgcc gccctatacc ttgtctgcct ccccgcgttg cgtcgcggtg catggagccg
     ggccacctcg acctgaatgg aagccggcgg cacctcgcta acggattcac cactccaaga
     attggagcca atcaattctt gcggagaact gtgaatgcgc aaaccaaccc ttggcagaac
     atatccatcg cgtccgccat ctccagcagc cgcacgcggc gcatctcggg cagcgttggg
     tcctggccac gggtgcgcat gatcgtgctc ctgtcgttga ggacccggct aggctggcgg
     ggttgcctta ctggttagca gaatgaatca ccgatacgcg agcgaacgtg aagcgactgc
     tgctgcaaaa cgtctgcgac ctgagcaaca acatgaatgg tcttcggttt ccgtgtttcg
     taaagtctgg aaacgcggaa gtcagcgccc tgcaccatta tgttccggat ctgcatcgca
     ggatgctgct ggctaccctg tggaacacct acatctgtat taacgaagcg ctggcattga
     ccctgagtga tttttctctg gtcccgccgc atccataccg ccagttgttt accctcacaa
     cgttccagta accgggcatg ttcatcatca gtaacccgta tcgtgagcat cctctctcgt
     ttcatcggta tcattacccc catgaacaga aattccccct tacacggagg catcaagtga
     ccaaacagga aaaaaccgcc cttaacatgg cccgctttat cagaagccag acattaacgc
     ttctggagaa actcaacgag ctggacgcgg atgaacaggc agacatctgt gaatcgcttc
     acgaccacgc tgatgagctt taccgcagct gcctcgcgcg tttcggtgat gacggtgaaa
     acctctgaca catgcagctc ccggagacgg tcacagcttg tctgtaagcg gatgccggga
     gcagacaagc ccgtcagggc gcgtcagcgg gtgttggcgg gtgtcggggc gcagccatga
     cccagtcacg tagcgatagc ggagtgtata ctggcttaac tatgcggcat cagagcagat
     tgtactgaga gtgcaccata tgcggtgtga aataccgcac agatgcgtaa ggagaaaata
     ccgcatcagg cgctcttccg cttcctcgct cactgactcg ctgcgctcgg tcgttcggct
     gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg ttatccacag aatcagggga
     taacgcagga aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc
     cgcgttgctg gcgtttttcc ataggctccg cccccctgac gagcatcaca aaaatcgacg
     ctcaagtcag aggtggcgaa acccgacagg actataaaga taccaggcgt ttccccctgg
     aagctccctc gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt
     tctcccttcg ggaagcgtgg cgctttctca tagctcacgc tgtaggtatc tcagttcggt
     gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg
     cgccttatcc ggtaactatc gtcttgagtc caacccggta agacacgact tatcgccact
     ggcagcagcc actggtaaca ggattagcag agcgaggtat gtaggcggtg ctacagagtt
     cttgaagtgg tggcctaact acggctacac tagaaggaca gtatttggta tctgcgctct
     gctgaagcca gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac
     cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc
     tcaagaagat cctttgatct tttctacggg gtctgacgct cagtggaacg aaaactcacg
     ttaagggatt ttggtcatga gattatcaaa aaggatcttc acctagatcc ttttaaatta
     aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa acttggtctg acagttacca
     atgcttaatc agtgaggcac ctatctcagc gatctgtcta tttcgttcat ccatagttgc
     ctgactcccc gtcgtgtaga taactacgat acgggagggc ttaccatctg gccccagtgc
     tgcaatgata ccgcgagacc cacgctcacc ggctccagat ttatcagcaa taaaccagcc
     agccggaagg gccgagcgca gaagtggtcc tgcaacttta tccgcctcca tccagtctat
     taattgttgc cgggaagcta gagtaagtag ttcgccagtt aatagtttgc gcaacgttgt
     tgccattgct gcaggcatcg tggtgtcacg ctcgtcgttt ggtatggctt cattcagctc
     cggttcccaa cgatcaaggc gagttacatg atcccccatg ttgtgcaaaa aagcggttag
     ctccttcggt cctccgatcg ttgtcagaag taagttggcc gcagtgttat cactcatggt
     tatggcagca ctgcataatt ctcttactgt catgccatcc gtaagatgct tttctgtgac
     tggtgagtac tcaaccaagt cattctgaga atagtgtatg cggcgaccga gttgctcttg
     cccggcgtca acacgggata ataccgcgcc acatagcaga actttaaaag tgctcatcat
     tggaaaacgt tcttcggggc gaaaactctc aaggatctta ccgctgttga gatccagttc
     gatgtaaccc actcgtgcac ccaactgatc ttcagcatct tttactttca ccagcgtttc
     tgggtgagca aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg cgacacggaa
     atgttgaata ctcatactct tcctttttca atattattga agcatttatc agggttattg
     tctcatgagc ggatacatat ttgaatgtat ttagaaaaat aaacaaatag gggttccgcg
     cacatttccc cgaaaagtgc cacctgacgt ctaagaaacc attattatca tgacattaac
     ctataaaaat aggcgtatca cgaggccctt tcgtcttcga ataaatacct gtgacggaag
     atcacttcgc agaataaata aatcctggtg tccctgttga taccgggaag ccctgggcca
     acttttggcg aaaatgagac gttgatcggc acgtaagagg ttccaacttt caccataatg
     aaataagatc actaccgggc gtattttttg agttatcgag attttcagga gctaaggaag
     ctaaaatgga gaaaaaaatc actggatata ccaccgttga tatatcccaa tggcatcgta
     aagaacattt tgaggcattt cagtcagttg ctcaatgtac ctataaccag accgttcagc
     tggatattac ggccttttta aagaccgtaa agaaaaataa gcacaagttt tatccggcct
     ttattcacat tcttgcccgc ctgatgaatg ctcatccgga attcgggacg atcacgatcc
     atccatttct taagaaatgg atgacgatcc atccatttct taagaaatgg atgacgatcc
     atccatttct tcccgaattc cgtatggcaa tgaaagacgg tgagctggtg atatgggata
     gtgttcaccc ttgttacacc gttttccatg agcaaactga aacgttttca tcgctctgga
     gtgaatacca cgacgatttc cggcagtttc tacacatata ttcgcaagat gtggcgtgtt
     acggtgaaaa cctggcctat ttccctaaag ggtttattga gaatatgttt ttcgtctcag
     ccaatccctg ggtgagtttc accagttttg atttaaacgt ggccaatatg gacaacttct
     tcgcccccgt tttcaccatg ggcaaatatt atacgcaagg cgacaaggtg ctgatgccgc
     tggcgattca ggttcatcat gccgtttgtg atggcttcca tgtcggcaga atgcttaatg
     aattacaaca gtactgcgat gagtggcagg gcggggcgta atttttttaa ggcagttatt
     ggtgccctta aacgcctggt gctacgcctg aataagtgat aataagcgga tgaatggcag
     aaattcgaaa gcaaattcga cccggtcgtc ggttcagggc agggtcgtta aatagccgct
     tatgtctatt gctggtttac cggtttattg actaccggaa gcagtgtgac cgtgtgcttc
     tcaaatgcct gaggccagtt tgctcaggct ctccccgtgg aggtaataat tgacgatatg
     atcatttatt ctgcctccca gagcctgata aaaacggtga atccgttagc gaggtgccgc
     cggcttccat tcaggtcgag gtggcccggc tccatgcacc gcgacgcaac gcggggaggc
     agacaaggta tagggcggcg cctacaatcc atgccaaccc gttccatgtg ctcgccgagg
     cggcataaat cgccgtgacg atcagcggtc cagtgatcga agttaggctg gtaagagccg
     cgagcgatcc ttgaagctgt ccctgatggt cgtcatctac ctgcctggac agcatggcct
     gcaacgcggg catcccgatg ccgccggaag cgagaagaat cataatgggg aaggccatcc
     agcctcgcgt cgcgaacgcc agcaagacgt agcccagcgc gtcggccgcc atgccggcga
     taatggcctg cttctcgccg aaacgtttgg tggcgggacc agtgacgaag gcttgagcga
     gggcgtgcaa gattccgaat accgcaagcg ac
//