back Return to this vector's summary.
ID   PSSC1      preliminary; circular DNA; SYN; 2568 BP.
XX
AC   IG5008;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pSSC1 - complete, MCS.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pSSC1 from pBR327 & oligo
RA   Kuznedelov K.D., Kolocheva T.I., Rivkin M.I., Kumarev V.P.;
RT   "[Plasmid vector pSSC1 for cloning synthetic polynucleotides and
RT   their regeneration with a unique nucleotide sequence]";
RL   Bioorg. Khim. 12:842-844(1986).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   MCS, oligonucleotide linker.
CC   NM (pSSC1)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning with cohesive ends)
CC   SE ()
CC   PA (pBR327)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR327 remove PstI-EcoRI 748bp 2524..3272,
FT                   \ 2525bp
FT                   2. oligo 43bp
FT                   \ ctgcaaggatgacgcgaattctcctgcaggcgtcatccaattc
FT                   -> pSSC1 2606 bp"
FT   -               1..2523
FT                   /note="pBR327 1..2523 2523bp
FT                   PstI = CTGCA^G
FT                   \            ctgcaag..."
FT   -               2524..2566
FT                   /note="43bp
FT                   \ ctgcaaggatgacgcgaattctcctgcaggcgtcatccaattc
FT                   \ ...aattc
FT                   EcoRI =  G^AATTC"
FT   -               2567..2568
FT                   /note="pBR327 3272..3273 2bp"
FT   CDS             0..0
FT                   /note="ANT E. coli tetracycline resistance gene (tet),
FT                   from pBR327"
FT   rep_origin      complement(0..0)
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322),
FT                   from pBR327"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp), from pBR327"
FT   misc_binding    7..38
FT                   /note="MCS FokI-HgaI-EcoRI-PstI-HgaI-FokI,
FT                   from oligonucleotide inserted into pBR327 EcoRI-PstI"
FT   misc_binding    7..11
FT                   /note="SIT FokI"
FT   misc_binding    9..13
FT                   /note="SIT HgaI"
FT   misc_binding    16..21
FT                   /note="SIT EcoRI"
FT   misc_binding    24..29
FT                   /note="SIT PstI"
FT   misc_binding    30..34
FT                   /note="SIT HgaI"
FT   misc_binding    34..38
FT                   /note="SIT FokI"
XX
SQ   Sequence 2568 BP; 527 A; 749 C; 682 G; 610 T; 0 other;
     ttctcatgtt tgacagctta tcatcgataa gctttaatgc ggtagtttat cacagttaaa
     ttgctaacgc agtcaggcac cgtgtatgaa atctaacaat gcgctcatcg tcatcctcgg
     caccgtcacc ctggatgctg taggcatagg cttggttatg ccggtactgc cgggcctctt
     gcgggatatc gtccattccg acagcatcgc cagtcactat ggcgtgctgc tagcgctata
     tgcgttgatg caatttctat gcgcacccgt tctcggagca ctgtccgacc gctttggccg
     ccgcccagtc ctgctcgctt cgctacttgg agccactatc gactacgcga tcatggcgac
     cacacccgtc ctgtggatcc tctacgccgg acgcatcgtg gccggcatca ccggcgccac
     aggtgcggtt gctggcgcct atatcgccga catcaccgat ggggaagatc gggctcgcca
     cttcgggctc atgagcgctt gtttcggcgt gggtatggtg gcaggcccgt ggccggggga
     ctgttgggcg ccatctcctt gcatgcacca ttccttgcgg cggcggtgct caacggcctc
     aacctactac tgggctgctt cctaatgcag gagtcgcata agggagagcg tcgaccgatg
     cccttgagag ccttcaaccc agtcagctcc ttccggtggg cgcggggcat gactatcgtc
     gccgcactta tgactgtctt ctttatcatg caactcgtag gacaggtgcc ggcagcgctc
     tgggtcattt tcggcgagga ccgctttcgc tggagcgcga cgatgatcgg cctgtcgctt
     gcggtattcg gaatcttgca cgccctcgct caagccttcg tcactggtcc cgccaccaaa
     cgtttcggcg agaagcaggc cattatcgcc ggcatggcgg ccgacgcgct gggctacgtc
     ttgctggcgt tcgcgacgcg aggctggatg gccttcccca ttatgattct tctcgcttcc
     ggcggcatcg ggatgcccgc gttgcaggcc atgctgtcca ggcaggtaga tgacgaccat
     cagggacagc ttcaaggatc gctcgcggct cttaccagcc taacttcgat cactggaccg
     ctgatcgtca cggcgattta tgccgcctcg gcgagcacat ggaacgggtt ggcatggatt
     gtaggcgccg ccctatacct tgtctgcctc cccgcgttgc gtcgcggtgc atggagccgg
     gccacctcga cctgaatgga agccggcggc acctcgctaa cggattcacc actccaagaa
     ttggagccaa tcaattcttg cggagaactg tgaatgcgca aaccaaccct tggcagaaca
     tatccatcgc gtccgccatc tccagcagcc gcacgcggcg catctcgggc cgcgttgctg
     gcgtttttcc ataggctccg cccccctgac gagcatcaca aaaatcgacg ctcaagtcag
     aggtggcgaa acccgacagg actataaaga taccaggcgt ttccccctgg aagctccctc
     gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt tctcccttcg
     ggaagcgtgg cgctttctca atgctcacgc tgtaggtatc tcagttcggt gtaggtcgtt
     cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc
     ggtaactatc gtcttgagtc caacccggta agacacgact tatcgccact ggcagcagcc
     actggtaaca ggattagcag agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg
     tggcctaact acggctacac tagaaggaca gtatttggta tctgcgctct gctgaagcca
     gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac cgctggtagc
     ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat
     cctttgatct tttctacggg gtctgacgct cagtggaacg aaaactcacg ttaagggatt
     ttggtcatga gattatcaaa aaggatcttc acctagatcc ttttaaatta aaaatgaagt
     tttaaatcaa tctaaagtat atatgagtaa acttggtctg acagttacca atgcttaatc
     agtgaggcac ctatctcagc gatctgtcta tttcgttcat ccatagttgc ctgactcccc
     gtcgtgtaga taactacgat acgggagggc ttaccatctg gccccagtgc tgcaatgata
     ccgcgagacc cacgctcacc ggctccagat ttatcagcaa taaaccagcc agccggaagg
     gccgagcgca gaagtggtcc tgcaacttta tccgcctcca tccagtctat taattgttgc
     cgggaagcta gagtaagtag ttcgccagtt aatagtttgc gcaacgttgt tgccattgct
     gcactgcaag gatgacgcga attctcctgc aggcgtcatc caattcaa
//