back Return to this vector's summary.
ID   PSTP1      preliminary; circular DNA; SYN; 3718 BP.
XX
AC   IG8051;
XX
DT   01-DEC-1994 (Rel. 10, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pSTP1 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   phage JW30 from phage JW19(22)
RC   pSTP1, pSTP2 from pAT153 & synthetic E.coli trp promoter/operator/RBS
RC   pJDW21 from pAT153 & phage JW30
RC   pJDW22 from pJDW21 & pIFS1, alpha-interferon gene
RC   pJDW30 from pJDW22 & pSTP2
RC   pIFS200 series from pJDW30 & oligo
RA   Windass J.D., Newton C.R., DeMaeyer-Guignard J., Moore V.E.,
RA   Markham A.F., Edge M.D.;
RT   "The construction of a synthetic Escherichia coli trp promoter and
RT   its use in the expression of a synthetic interferon gene";
RL   Nucleic Acids Res. 10:6639-6657(1982).
XX
RN   [2]
RC   pIFS1 from alpha-interferon gene
RA   Edge M.D., Green A.R., Heathcliffe G.R., Meacock P.A., Schuch W.,
RA   Scanlon D.B., Atkinson T.C., Newton C.R., Markham A.F.;
RT   "Total synthesis of a human leukocyte interferon gene";
RL   Nature 292:756-762(1981).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pSTP1)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN ()
CC   SE ()
CC   PA (pAT153)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pAT153 remove EcoRI-ClaI 26bp
FT                   \ 3657..3658..25, 3632bp
FT                   2. oligo EcoRI-ClaI/TaqI 82bp, trp promoter/oper/RBS
FT                   \ aattctggcaaatattctgaaatgagctgttgacaattaatcatcgaact
FT                   \ agttaactagtacgcaagttcacgtaaaaagggtat
FT                   -> pSTP1 3720bp"
FT   -               1..3632
FT                   /note="pAT153 25..3656 3632bp
FT                   EcoRI = G^AATTC
FT                   \         aattc..."
FT   -               3633..3718
FT                   /note="86bp
FT                   \ aattctggcaaatattctgaaatgagctgttgacaattaatcatcgaact
FT                   \ agttaactagtacgcaagttcacgtaaaaagggtat
FT                   \ ...gggtat
FT                   ClaI =   AT^CGAT"
FT   misc_binding    0..0
FT                   /note="MCS EcoRI-HincII-HincII/HpaI-ClaI-HindIII"
FT   CDS             0..0
FT                   /note="ANT E. coli tet gene"
FT   CDS             0..0
FT                   /note="ANT E. coli amp gene"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 3718 BP; 837 A; 1019 C; 965 G; 897 T; 0 other;
     cgataagctt taatgcggta gtttatcaca gttaaattgc taacgcagtc aggcaccgtg
     tatgaaatct aacaatgcgc tcatcgtcat cctcggcacc gtcaccctgg atgctgtagg
     cataggcttg gttatgccgg tactgccggg cctcttgcgg gatatcgtcc attccgacag
     catcgccagt cactatggcg tgctgctagc gctatatgcg ttgatgcaat ttctatgcgc
     acccgttctc ggagcactgt ccgaccgctt tggccgccgc ccagtcctgc tcgcttcgct
     acttggagcc actatcgact acgcgatcat ggcgaccaca cccgtcctgt ggatcctcta
     cgccggacgc atcgtggccg gcatcaccgg cgccacaggt gcggttgctg gcgcctatat
     cgccgacatc accgatgggg aagatcgggc tcgccacttc gggctcatga gcgcttgttt
     cggcgtgggt atggtggcag gccccgtggc cgggggactg ttgggcgcca tctccttgca
     tgcaccattc cttgcggcgg cggtgctcaa cggcctcaac ctactactgg gctgcttcct
     aatgcaggag tcgcataagg gagagcgtcg accgatgccc ttgagagcct tcaacccagt
     cagctccttc cggtgggcgc ggggcatgac tatcgtcgcc gcacttatga ctgtcttctt
     tatcatgcaa ctcgtaggac aggtgccggc agcgctctgg gtcattttcg gcgaggaccg
     ctttcgctgg agcgcgacga tgatcggcct gtcgcttgcg gtattcggaa tcttgcacgc
     cctcgctcaa gccttcgtca ctggtcccgc caccaaacgt ttcggcgaga agcaggccat
     tatcgccggc atggcggccg acgcgctggg ctacgtcttg ctggcgttcg cgacgcgagg
     ctggatggcc ttccccatta tgattcttct cgcttccggc ggcatcggga tgcccgcgtt
     gcaggccatg ctgtccaggc aggtagatga cgaccatcag ggacagcttc aaggatcgct
     cgcggctctt accagcctaa cttcgatcac tggaccgctg atcgtcacgg cgatttatgc
     cgcctcggcg agcacatgga acgggttggc atggattgta ggcgccgccc tataccttgt
     ctgcctcccc gcgttgcgtc gcggtgcatg gagccgggcc acctcgacct gaatggaagc
     cggcggcacc tcgctaacgg attcaccact ccaagaattg gagccaatca attcttgcgg
     agaactgtga atgcgcaaac caacccttgg cagaacatat ccatcgcgtc cgccatctcc
     agcagccgca cgcggcgcat ctcgggcagc gttgggtcct ggccacgggt gcgcatgatc
     gtgctcctgt cgttgaggac ccggctaggc tggcggggtt gccttactgg ttagcagaat
     gaatcaccga tacgcgagcg aacgtgaagc gactgctgct gcaaaacgtc tgcgacctga
     gcaacaacat gaatggtctt cggtttccgt gtttcgtaaa gtctggaaac gcggaagtca
     gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc
     ggtatcagct cactcaaagg cggtaatacg gttatccaca gaatcagggg ataacgcagg
     aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct
     ggcgtttttc cataggctcc gcccccctga cgagcatcac aaaaatcgac gctcaagtca
     gaggtggcga aacccgacag gactataaag ataccaggcg tttccccctg gaagctccct
     cgtgcgctct cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc
     gggaagcgtg gcgctttctc atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt
     tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct gcgccttatc
     cggtaactat cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc
     cactggtaac aggattagca gagcgaggta tgtaggcggt gctacagagt tcttgaagtg
     gtggcctaac tacggctaca ctagaaggac agtatttggt atctgcgctc tgctgaagcc
     agttaccttc ggaaaaagag ttggtagctc ttgatccggc aaacaaacca ccgctggtag
     cggtggtttt tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga
     tcctttgatc ttttctacgg ggtctgacgc tcagtggaac gaaaactcac gttaagggat
     tttggtcatg agattatcaa aaaggatctt cacctagatc cttttaaatt aaaaatgaag
     ttttaaatca atctaaagta tatatgagta aacttggtct gacagttacc aatgcttaat
     cagtgaggca cctatctcag cgatctgtct atttcgttca tccatagttg cctgactccc
     cgtcgtgtag ataactacga tacgggaggg cttaccatct ggccccagtg ctgcaatgat
     accgcgagac ccacgctcac cggctccaga tttatcagca ataaaccagc cagccggaag
     ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc atccagtcta ttaattgttg
     ccgggaagct agagtaagta gttcgccagt taatagtttg cgcaacgttg ttgccattgc
     tgcaggcatc gtggtgtcac gctcgtcgtt tggtatggct tcattcagct ccggttccca
     acgatcaagg cgagttacat gatcccccat gttgtgcaaa aaagcggtta gctccttcgg
     tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta tcactcatgg ttatggcagc
     actgcataat tctcttactg tcatgccatc cgtaagatgc ttttctgtga ctggtgagta
     ctcaaccaag tcattctgag aatagtgtat gcggcgaccg agttgctctt gcccggcgtc
     aacacgggat aataccgcgc cacatagcag aactttaaaa gtgctcatca ttggaaaacg
     ttcttcgggg cgaaaactct caaggatctt accgctgttg agatccagtt cgatgtaacc
     cactcgtgca cccaactgat cttcagcatc ttttactttc accagcgttt ctgggtgagc
     aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat
     actcatactc ttcctttttc aatattattg aagcatttat cagggttatt gtctcatgag
     cggatacata tttgaatgta tttagaaaaa taaacaaata ggggttccgc gcacatttcc
     ccgaaaagtg ccacctgacg tctaagaaac cattattatc atgacattaa cctataaaaa
     taggcgtatc acgaggccct ttcgtcttca agaattctgg caaatattct gaaatgagct
     gttgacaatt aatcatcgaa ctagttaact agtacgcaag ttcacgtaaa aagggtat
//