back Return to this vector's summary.
ID   PSVSPORT1  preliminary; circular DNA; SYN; 3160 BP.
XX
AC   U14626; IG1152;
XX
DT   02-NOV-1992 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli phagemid vector pSV-SPORT1 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pSV-SPORT1 from pKO-neo & pSPORT1
RA   Crouse J.E.;
RT   "Plasmid pSV-SPORT1";
RL   GibcoBRL Catalogue 93:7p16-7p17(1993).
RL   Crouse J.E., Life Technologies Inc., Gaithersburg MD 20877.
XX
RN   [2]
RC   pSV-SPORT1 from pKO-neo & pSPORT1
RA   D'Alessio J.M.;
RT   ;
RL   Unpublished (1994).
RL   Life Technologies, Inc. Catalogue.
XX
RN   [3]
RC   pSV-SPORT1, lacZ gene
RA   Horton M.E.;
RT   ;
RL   Submitted (12-SEP-1994) by:
RL   Horton M.E., Life Technologies, Inc., Technical Services,
RL   8400 Helgerman Court, Gaithersburg, MD 20884-9980, USA.
XX
CC   NCBI gi: 540252
CC   NM (pSV-SPORT1)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (phagemid)
CC   SP (BRL)
CC   HO (E.coli DH5alpha)
CC   CP ()
CC   FN (expression transient)(shuttle bacteria/mammal)
CC   FN (in vitro mutagenesis)(sequencing dideoxy)
CC   FN (cloning random/oriented cDNA)
CC   SE ()
CC   PA (pKO-neo)
CC   BR (pSPORT1)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 remove small EcoRI-HindIII 31bp
FT                   \ 4360..4361..30, 4330bp
FT                   2. SV40 HindIII-PvuII 344bp 5172..5243..273,
FT                   \ ori/early promoter
FT                   3. E. coli AluI-EcoRI 95bp, lacUV5 promoter
FT                   \ ctcactcattaggcaccccaggctttacactttatgcttccggctcgtat
FT                   \ aatgtgtggaattgtgagcggataacaatttcacacaggaaacag
FT                   -> plasmid 4769bp
FT                   1. plasmid BamHI-HindIII 4423bp, SV40 ori/early prom
FT                   \ pBR322 376..4360..-..- [remove 346bp]
FT                   2. SV40 MboI-MboI 610bp 4101..4711, intron [615bp]
FT                   Klenow:Klenow
FT                   HindIII linker 10bp nnaagcttnn:HindIII linker 10bp
FT                   \ nnaagcttnn
FT                   HindIII-HindIII 615bp
FT                   HinfI-HindIII 143bp 4570..4713, [147bp]
FT                   \ SV40 small t intron
FT                   3. SV40 BamHI-HinfI 291bp 2534..2825, polyA [289bp]
FT                   -> pko 4857bp
FT                   1. Tn5 HindIII-BamHI 1861bp 1196..3057,
FT                   \ neo/kan gene with BglII
FT                   -> plasmid2
FT                   1. pko
FT                   2. plasmid2 HindIII-BamHI 1861bp 1196..3057,
FT                   \ neo/kan gene with BglII
FT                   -> pKO-neo 3747bp
FT                   1. pSPORT1 AatII-PstI 89bp 196..285, MCS
FT                   2. pKO-neo remove PstI-AatII 677bp, pBR322 3614..4291
FT                   \ 3070bp
FT                   -> pSV1-SPORT 3160bp"
FT   promoter        23..166
FT                   /note="PRO SV40 early genes enhancer"
FT   promoter        170..232
FT                   /note="PRO SV40 early genes"
FT   misc_binding    231..231
FT                   /note="SIT unique DsaI"
FT   misc_binding    231..231
FT                   /note="SIT unique NcoI"
FT   rep_origin      260..286
FT                   /note="ORI SV40"
FT   misc_binding    270..270
FT                   /note="SIT unique SfiI"
FT   misc_binding    321..321
FT                   /note="SIT unique StuI"
FT   misc_binding    324..324
FT                   /note="SIT unique AvrII"
FT   promoter        345..364
FT                   /note="PRO bacteriophage Sp6"
FT   misc_binding    371..466
FT                   /note="MCS PstI-KpnI-RsrII-BspMII-EcoRI-SmaI-SalI-
FT                   SstI-SpeI-NotI-XmaIII-XbaI-HindIII-SnaBI-SplI-MluI"
FT   promoter        complement(476..496)
FT                   /note="PRO bacteriophage T7"
FT   CDS             complement(>2500..3536)
FT                   /note="GEN SV40 small t-intron region"
FT   misc_feature    complement(>500..<880)
FT                   /note="SPL SV40 72 base insertion"
FT   misc_binding    629..629
FT                   /note="SIT unique NdeI"
FT   misc_binding    776..776
FT                   /note="SIT unique BclI"
FT   misc_binding    777..777
FT                   /note="SIT unique MamI"
FT   misc_binding    869..869
FT                   /note="SIT unique MunI"
FT   misc_binding    880..880
FT                   /note="SIT unique HpaI"
FT   polyA_signal    912..919
FT                   /note="PLA SV40 early genes"
FT   polyA_signal    941..948
FT                   /note="PLA SV40 early genes"
FT   rep_origin      1146..1170
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             complement(2003..2863)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   misc_binding    2296..2296
FT                   /note="SIT unique FspI"
FT   misc_binding    2443..2443
FT                   /note="SIT unique PvuI"
FT   misc_binding    2554..2554
FT                   /note="SIT unique ScaI"
FT   misc_binding    2671..2671
FT                   /note="SIT unique XmnI"
FT   promoter        complement(>3050..<3154)
FT                   /note="PRO E. coli lacUV5 gene"
XX
SQ   Sequence 3160 BP; 820 A; 775 C; 724 G; 841 T; 0 other;
     ctgtggaatg tgtgtcagtt agggtgtgga aagtccccag gctccccagc aggcagaagt
     atgcaaagca tgcatctcaa ttagtcagca accaggtgtg gaaagtcccc aggctcccca
     gcaggcagaa gtatgcaaag catgcatctc aattagtcag caaccatagt cccgccccta
     actccgccca tcccgcccct aactccgccc agttccgccc attctccgcc ccatggcgta
     ctaatttttt ttatttatgc agaggccgag gccgcctcgg cctctgagct attccagaag
     tagtgaggag gcttttttgg aggcctaggc ttttgcaaaa agctatttag gtgacactat
     agaaggtacg cctgcaggta ccggtccgga attcccgggt cgacgagctc actagtcggc
     ggccgctcta gaggatccaa gcttacgtac gcgtgcatgc gacgtcatag ctctctccct
     atagtgagtc gtattataag ctagcttggg atctttgtga aggaacctta cttctgtggt
     gtgacataat tggacaaact acctacagag atttaaagct ctaaggtaaa tataaaattt
     ttaagtgtat aatgtgttaa actagctgca tatgcttgct gcttgagagt tttgcttact
     gagtatgatt tatgaaaata ttatacacag gagctagtga ttctaattgt ttgtgtattt
     tagattcaca gtcccaaggc tcatttcagg cccctcagtc ctcacagtct gttcatgatc
     ataatcagcc ataccacatt tgtagaggtt ttacttgctt taaaaaacct cccacacctc
     cccctgaacc tgaaacataa aatgaatgca attgttgttg ttaacttgtt tattgcagct
     tataatggtt acaaataaag caatagcatc acaaatttca caaataaagc atttttttca
     ctgcattcta gttgtggttt gtccaaactc atcaatgtat cttatcatgt ctggatcctg
     cattaatgaa tcggccaacg cgcggggaga ggcggtttgc gtattgggcg ctcttccgct
     tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac
     tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga
     gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat
     aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac
     ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct
     gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg
     ctttctcaat gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg
     ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt
     cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg
     attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac
     ggctacacta gaaggacagt atttggtatc tgcggccagt taccttcgga aaaagagttg
     gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc
     agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt
     ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa
     ggatcttcac ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat
     atgagtaaac ttggtctgac agttaccaat gcttaatcag tgaggcacct atctcagcga
     tctgtctatt tcgttcatcc atagttgcct gactccccgt cgtgtagata actacgatac
     gggagggctt accatctggc cccagtgctg caatgatacc gcgagaccca cgctcaccgg
     ctccagattt atcagcaata aaccagccag ccggaagggc cgagcgcaga agtggtcctg
     caactttatc cgcctccatc cagtctatta attgttgccg ggaagctaga gtaagtagtt
     cgccagttaa tagtttgcgc aacgttgttg ccattgctac aggcatcgtg gtgtcacgct
     cgtcgtttgg tatggcttca ttcagctccg gttcccaacg atcaaggcga gttacatgat
     cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt gtcagaagta
     agttggccgc agtgttatca ctcatggtta tggcagcact gcataattct cttactgtca
     tgccatccgt aagatgcttt tctgtgactg gtgagtactc aaccaagtca ttctgagaat
     agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaat acgggataat accgcgccac
     atagcagaac tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga aaactctcaa
     ggatcttacc gctgttgaga tccagttcga tgtaacccac tcgtgcaccc aactgatctt
     cagcatcttt tactttcacc agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg
     caaaaaaggg aataagggcg acacggaaat gttgaatact catactcttc ctttttcaat
     attattgaag catttatcag ggttattgtc tcatgagcgg atacatattt gaatgtattt
     agaaaaataa acaaataggg gttccgcgca catttccccg aaaagtgcca cctgacgtct
     aagaaaccat tattatcatg acattaacct ataaaaatag gcgtatacga ggccctttca
     ctcattaggc accccaggct ttacacttta tagcttccgg ctcgtataat gtgtggaatt
     gtgagcggat aacaatttca cacaggaaac agcatcgatg
//