back Return to this vector's summary.
ID   PT7E19P    preliminary; circular DNA; SYN; 2937 BP.
XX
AC   X13070;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pT7E19+ - complete, MCS.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-93
RC   pT7E19+ from pUC19 & T7 promoter oligo & pTZ18U, f1 ori
RA   Petty I.T.;
RT   "A plasmid vector for cloning directly at the transcription
RT   initiation site of a bacteriophage T7 promoter";
RL   Nucleic Acids Res. 16:8738-8738(1988).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   MCS and promoter. oligonucleotide linker.
CC   NCBI gi: 58135
CC   NM (pT7E19+)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pTZ18U)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pTZ18U remove EcoRI-KpnI 16bp 256..272,
FT                   \ MCS/2844bp
FT                   2. oligo KpnI-SacI/SstI-EcoRI 93bp
FT                   \ cgccaagcttgcatgcctgcaggtcgactctagaggatccccgggtaccg
FT                   \ agctctatagtgagtcgtattaattcactggccgtcgttttac,
FT                   \ T7 promoter
FT                   -> pT7E19+ 2930bp [SstI at initiation site, no EcoRI]"
FT   -               1..255
FT                   /note="pTZ18U 1..255 255bp
FT                   EcoRI = G^AATTC
FT                   \         cgccaa..."
FT   -               256..348
FT                   /note="93bp
FT                   \ cgccaagcttgcatgcctgcaggtcgactctagaggatccccgggtaccg
FT                   \ agctctatagtgagtcgtattaattcactggccgtcgttttac
FT                   \   ...tttac
FT                   KpnI = GGTAC^C"
FT   -               349..2937
FT                   /note="pTZ18U 272..2860 2589bp"
FT   misc_binding    1..54
FT                   /note="MCS pUC19"
FT   misc_feature    55..55
FT                   /note="bacteriophage T7 transcription initiation site"
FT   promoter        56..72
FT                   /note="PRO bacteriophage T7"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   rep_origin      0..0
FT                   /note="ORI bacteriophage f1 intergenic region"
XX
SQ   Sequence 2937 BP; 714 A; 740 C; 730 G; 753 T; 0 other;
     agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc
     acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc
     tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa
     ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac gaatttaata
     cgactcacta tagggcgcca agcttgcatg cctgcaggtc gactctagag gatccccggg
     taccgagctc tatagtgagt cgtattaatt cactggccgt cgttttaccc ggggatcctc
     tagagtcgac ctgcaggcat gcaagcttgg cactggccgt cgttttacaa cgtcgtgact
     gggaaaaccc tggcgttacc caacttaatc gccttgcagc acatccccct ttcgccagct
     ggcgtaatag cgaagaggcc cgcaccgatc gcccttccca acagttgcgc agcctgaatg
     gcgaatggga cgcgccctgt agcggcgcat taagcgcggc gggtgtggtg gttacgcgca
     gcgtgaccgc tacacttgcc agcgccctag cgcccgctcc tttcgctttc ttcccttcct
     ttctcgccac gttcgccggc tttccccgtc aagctctaaa tcgggggctc cctttagggt
     tccgatttag tgctttacgg cacctcgacc ccaaaaaact tgattagggt gatggttcac
     gtagtgggcc atcgccctga tagacggttt ttcgcccttt gacgttggag tccacgttct
     ttaatagtgg actcttgttc caaactggaa caacactcaa ccctatctcg gtctattctt
     ttgatttata agggattttg ccgatttcgg cctattggtt aaaaaatgag ctgatttaac
     aaaaatttaa cgcgaatttt aacaaaatat taacgtttac aatttcaggt ggcacttttc
     ggggaaatgt gcgcggaacc cctatttgtt tatttttcta aatacattca aatatgtatc
     cgctcatgag acaataaccc tgataaatgc ttcaataata ttgaaaaagg aagagtatga
     gtattcaaca tttccgtgtc gcccttattc ccttttttgc ggcattttgc cttcctgttt
     ttgctcaccc agaaacgctg gtgaaagtaa aagatgctga agatcagttg ggtgcacgag
     tgggttacat cgaactggat ctcaacagcg gtaagatcct tgagagtttt cgccccgaag
     aacgttttcc aatgatgagc acttttaaag ttctgctatg tggcgcggta ttatcccgta
     ttgacgccgg gcaagagcaa ctcggtcgcc gcatacacta ttctcagaat gacttggttg
     agtactcacc agtcacagaa aagcatctta cggatggcat gacagtaaga gaattatgca
     gtgctgccat aaccatgagt gataacactg cggccaactt acttctgaca acgatcggag
     gaccgaagga gctaaccgct tttttgcaca acatggggga tcatgtaact cgccttgatc
     gttgggaacc ggagctgaat gaagccatac caaacgacga gcgtgacacc acgatgcctg
     tagcaatggc aacaacgttg cgcaaactat taactggcga actacttact ctagcttccc
     ggcaacaatt aatagactgg atggaggcgg ataaagttgc aggaccactt ctgcgctcgg
     cccttccggc tggctggttt attgctgata aatctggagc cggtgagcgt gggtctcgcg
     gtatcattgc agcactgggg ccagatggta agccctcccg tatcgtagtt atctacacga
     cggggagtca ggcaactatg gatgaacgaa atagacagat cgctgagata ggtgcctcac
     tgattaagca ttggtaactg tcagaccaag tttactcata tatactttag attgatttaa
     aacttcattt ttaatttaaa aggatctagg tgaagatcct ttttgataat ctcatgacca
     aaatccctta acgtgagttt tcgttccact gagcgtcaga ccccgtagaa aagatcaaag
     gatcttcttg agatcctttt tttctgcgcg taatctgctg cttgcaaaca aaaaaaccac
     cgctaccagc ggtggtttgt ttgccggatc aagagctacc aactcttttt ccgaaggtaa
     ctggcttcag cagagcgcag ataccaaata ctgtccttct agtgtagccg tagttaggcc
     accacttcaa gaactctgta gcaccgccta catacctcgc tctgctaatc ctgttaccag
     tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga cgatagttac
     cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg cacacagccc agcttggagc
     gaacgaccta caccgaactg agatacctac agcgtgagca ttgagaaagc gccacgcttc
     ccgaagggag aaaggcggac aggtatccgg taagcggcag ggtcggaaca ggagagcgca
     cgagggagct tccaggggga aacgcctggt atctttatag tcctgtcggg tttcgccacc
     tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta tggaaaaacg
     ccagcaacgc ggccttttta cggttcctgg ccttttgctg gccttttgct cacatgttct
     ttcctgcgtt atcccctgat tctgtggata accgtattac cgcctttgag tgagctgata
     ccgctcgccg cagccgaacg accgagcgca gcgagtcagt gagcgaggaa gcggaag
//