back Return to this vector's summary.
ID   PTAC11     preliminary; circular DNA; SYN; 4609 BP.
XX
AC   K01728; ATCC37245;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector ptac11 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   [pKB277 from pKB series]
RC   ptac11, ptac12, ptac12H from pBR322 & tac promoter
RC   pEA300, pEA301 from pKK84-1 & ptac11
RC   pEA302T, pEA303, pEA305, pEA306 from pEA300 & pEA301 & pKB277
RA   Amann E., Brosius J., Ptashne M.;
RT   "Vectors bearing a hybrid trp-lac promoter useful for regulated
RT   expression of cloned genes in Escherichia coli";
RL   Gene 25:167-178(1983).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   Contains the lac operator.  The unique EcoRI site is 7 bp downstream
CC   of the lacZ ribosome-binding sequence.
CC   The tac promoter can be excised by a EcoRI/HindIII digest.
CC   Medium is 1227 LB plus ampicillin.
CC   NM (ptac11)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli RB791)(E.coli)(E.coli HB101)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR322)(tac promoter)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 HindIII 4361bp 30..30
FT                   2. E. coli TaqI-PvuII 244bp, tac promoter
FT                   \ cgactgcacggtgaccaatgcttctggcgtcaggcagccatcggaagctg
FT                   \ tggtatggctgtgcaggtcgtaaatcactgcataattcgtgtcgctcaag
FT                   \ gcgcactcccgttctggataatgttttttgcgccgacatcataacggttc
FT                   \ tggcaaatattctgaaatgagctgttgacaattaatcatcggctcgtata
FT                   \ atgtgtggaattgtgagcggataacaatttcacacaggaaacag
FT                   -> ptac11 4605bp"
FT   -               1..33
FT                   /note="pBR322 1..33 33bp
FT                   HindIII = A^AGCT T
FT                   \                cgactg..."
FT   -               34..277
FT                   /note="244bp
FT                   \ cgactgcacggtgaccaatgcttctggcgtcaggcagccatcggaagctg
FT                   \ tggtatggctgtgcaggtcgtaaatcactgcataattcgtgtcgctcaag
FT                   \ gcgcactcccgttctggataatgttttttgcgccgacatcataacggttc
FT                   \ tggcaaatattctgaaatgagctgttgacaattaatcatcggctcgtata
FT                   \ atgtgtggaattgtgagcggataacaatttcacacaggaaacag
FT                   \  ...aacag
FT                   HindIII = A^AGCTT"
FT   -               278..4609
FT                   /note="pBR322 30..4361 4332bp"
FT   misc_binding    0..0
FT                   /note="SIT unique EcoRI"
FT   misc_binding    0..0
FT                   /note="SIT unique HindIII"
FT   misc_binding    0..0
FT                   /note="SIT unique PstI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   promoter        0..0
FT                   /note="PRO E. coli tac"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 4609 BP; 1046 A; 1264 C; 1198 G; 1101 T; 0 other;
     ttctcatgtt tgacagctta tcatcgataa gctcgactgc acggtgacca atgcttctgg
     cgtcaggcag ccatcggaag ctgtggtatg gctgtgcagg tcgtaaatca ctgcataatt
     cgtgtcgctc aaggcgcact cccgttctgg ataatgtttt ttgcgccgac atcataacgg
     ttctggcaaa tattctgaaa tgagctgttg acaattaatc atcggctcgt ataatgtgtg
     gaattgtgag cggataacaa tttcacacag gaaacagagc tttaatgcgg tagtttatca
     cagttaaatt gctaacgcag tcaggcaccg tgtatgaaat ctaacaatgc gctcatcgtc
     atcctcggca ccgtcaccct ggatgctgta ggcataggct tggttatgcc ggtactgccg
     ggcctcttgc gggatatcgt ccattccgac agcatcgcca gtcactatgg cgtgctgcta
     gcgctatatg cgttgatgca atttctatgc gcacccgttc tcggagcact gtccgaccgc
     tttggccgcc gcccagtcct gctcgcttcg ctacttggag ccactatcga ctacgcgatc
     atggcgacca cacccgtcct gtggatcctc tacgccggac gcatcgtggc cggcatcacc
     ggcgccacag gtgcggttgc tggcgcctat atcgccgaca tcaccgatgg ggaagatcgg
     gctcgccact tcgggctcat gagcgcttgt ttcggcgtgg gtatggtggc aggccccgtg
     gccgggggac tgttgggcgc catctccttg catgcaccat tccttgcggc ggcggtgctc
     aacggcctca acctactact gggctgcttc ctaatgcagg agtcgcataa gggagagcgt
     cgaccgatgc ccttgagagc cttcaaccca gtcagctcct tccggtgggc gcggggcatg
     actatcgtcg ccgcacttat gactgtcttc tttatcatgc aactcgtagg acaggtgccg
     gcagcgctct gggtcatttt cggcgaggac cgctttcgct ggagcgcgac gatgatcggc
     ctgtcgcttg cggtattcgg aatcttgcac gccctcgctc aagccttcgt cactggtccc
     gccaccaaac gtttcggcga gaagcaggcc attatcgccg gcatggcggc cgacgcgctg
     ggctacgtct tgctggcgtt cgcgacgcga ggctggatgg ccttccccat tatgattctt
     ctcgcttccg gcggcatcgg gatgcccgcg ttgcaggcca tgctgtccag gcaggtagat
     gacgaccatc agggacagct tcaaggatcg ctcgcggctc ttaccagcct aacttcgatc
     actggaccgc tgatcgtcac ggcgatttat gccgcctcgg cgagcacatg gaacgggttg
     gcatggattg taggcgccgc cctatacctt gtctgcctcc ccgcgttgcg tcgcggtgca
     tggagccggg ccacctcgac ctgaatggaa gccggcggca cctcgctaac ggattcacca
     ctccaagaat tggagccaat caattcttgc ggagaactgt gaatgcgcaa accaaccctt
     ggcagaacat atccatcgcg tccgccatct ccagcagccg cacgcggcgc atctcgggca
     gcgttgggtc ctggccacgg gtgcgcatga tcgtgctcct gtcgttgagg acccggctag
     gctggcgggg ttgccttact ggttagcaga atgaatcacc gatacgcgag cgaacgtgaa
     gcgactgctg ctgcaaaacg tctgcgacct gagcaacaac atgaatggtc ttcggtttcc
     gtgtttcgta aagtctggaa acgcggaagt cagcgccctg caccattatg ttccggatct
     gcatcgcagg atgctgctgg ctaccctgtg gaacacctac atctgtatta acgaagcgct
     ggcattgacc ctgagtgatt tttctctggt cccgccgcat ccataccgcc agttgtttac
     cctcacaacg ttccagtaac cgggcatgtt catcatcagt aacccgtatc gtgagcatcc
     tctctcgttt catcggtatc attaccccca tgaacagaaa tcccccttac acggaggcat
     cagtgaccaa acaggaaaaa accgccctta acatggcccg ctttatcaga agccagacat
     taacgcttct ggagaaactc aacgagctgg acgcggatga acaggcagac atctgtgaat
     cgcttcacga ccacgctgat gagctttacc gcagctgcct cgcgcgtttc ggtgatgacg
     gtgaaaacct ctgacacatg cagctcccgg agacggtcac agcttgtctg taagcggatg
     ccgggagcag acaagcccgt cagggcgcgt cagcgggtgt tggcgggtgt cggggcgcag
     ccatgaccca gtcacgtagc gatagcggag tgtatactgg cttaactatg cggcatcaga
     gcagattgta ctgagagtgc accatatgcg gtgtgaaata ccgcacagat gcgtaaggag
     aaaataccgc atcaggcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt
     tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc
     aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa
     aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa
     tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc
     ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc
     cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta ggtatctcag
     ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga
     ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc
     gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac
     agagttcttg aagtggtggc ctaactacgg ctacactaga aggacagtat ttggtatctg
     cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca
     aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa
     aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa
     ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt
     aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag
     ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat
     agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc
     cagtgctgca atgataccgc gagacccacg ctcaccggct ccagatttat cagcaataaa
     ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca
     gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa
     cgttgttgcc attgctgcag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt
     cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc
     ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact
     catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc
     tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg
     ctcttgcccg gcgtcaacac gggataatac cgcgccacat agcagaactt taaaagtgct
     catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc
     cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta ctttcaccag
     cgtttctggg tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa taagggcgac
     acggaaatgt tgaatactca tactcttcct ttttcaatat tattgaagca tttatcaggg
     ttattgtctc atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt
     tccgcgcaca tttccccgaa aagtgccacc tgacgtctaa gaaaccatta ttatcatgac
     attaacctat aaaaataggc gtatcacgag gccctttcgt cttcaagaa
//