back Return to this vector's summary.
ID   PTAC12H    preliminary; circular DNA; SYN; 5509 BP.
AC   K01728; ATCC37246;
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
DE   E. coli plasmid vector ptac12H - complete.
KW   cloning vector.
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
RN   [1]
RC   [pKB277 from pKB series]
RC   ptac11, ptac12, ptac12H from pBR322 & tac promoter
RC   pEA300, pEA301 from pKK84-1 & ptac11
RC   pEA302T, pEA303, pEA305, pEA306 from pEA300 & pEA301 & pKB277
RA   Amann E., Brosius J., Ptashne M.;
RT   "Vectors bearing a hybrid trp-lac promoter useful for regulated
RT   expression of cloned genes in Escherichia coli";
RL   Gene 25:167-178(1983).
CC   Created by Moore, July 1995, under contract with NCBI.
CC   Contains the lac operator.  The unique HindIII site is 10 bp
CC   downstream of the lacZ ribosome-binding sequence.
CC   Medium is 1227 LB plus ampicillin.
CC   NM (ptac12H)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   HO (E.coli RB791)(E.coli)(E.coli HB101)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBR322)(tac promoter)
CC   BR ()
CC   OF ()
CC   OR ()
FH   Key             Location/Qualifiers
FT   misc_feature    0..0
FT                   /note="1. ptac12 HindIII 5507bp, pBR322 30..30
FT                   fill in
FT                   -> ptac12H 5507bp [2600bp;unique HindIII in lac]"
FT   -               1..5246
FT                   /note="pKK84-1 1..5246 5246bp
FT                   ClaI = AT^CGAT
FT                   \         cggctc..."
FT   -               5247..5301
FT                   /note="55bp
FT                   \ cggctcgtataatgtgtggaattgtgagcggataacaatttcacacagga
FT                   \ aacag
FT                   \ ...ggaaacag
FT                   \            cgactgca..."
FT   -               5302..5491
FT                   /note="ptac11 190bp
FT                   \ cgactgcacggtgcaccaatgcttctggcgtcaggcagccatcggaagct
FT                   \ gtggtatggctgtgcaggtcgtaaatcactgcataattcgtgtcgctcaa
FT                   \ ggcgcactcccgttctggataatgttttttgcgccgacatcataacggtt
FT                   \ ctggcaaatattctgaaatgagctgttgacaattaatcat
FT                   TaqI =  T^CGA
FT                   ClaI = AT^CGAT"
FT   -               5492..5500
FT                   /note="pKK84-1 5247..5255 9bp
FT                   HindIII = A^AGCT T
FT                   HindIII =      A^AGCTT"
FT   -               5501..5509
FT                   /note="pKK84-1 5252..5260 9bp"
FT   misc_binding    0..0
FT                   /note="SIT unique HindIII-EcoRI-PvuII"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   promoter        0..0
FT                   /note="PRO E. coli tac"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
SQ   Sequence 5509 BP; 1276 A; 1487 C; 1452 G; 1294 T; 0 other;
     gatgctgtag gcataggctt ggttatgccg gtactgccgg gcctcttgcg ggatatcgtc
     cattccgaca gcatcgccag tcactatggc gtgctgctag cgctatatgc gttgatgcaa
     tttctatgcg cacccgttct cggagcactg tccgaccgct ttggccgccg cccagtcctg
     ctcgcttcgc tacttggagc cactatcgac tacgcgatca tggcgaccac acccgtcctg
     tggatcctct acgccggacg catcgtggcc ggcatcaccg gcgccacagg tgcggttgct
     ggcgcctata tcgccgacat caccgatggg gaagatcggg ctcgccactt cgggctcatg
     agcgcttgtt tcggcgtggg tatggtggca ggccccgtgg ccgggggact gttgggcgcc
     atctccttgc atgcaccatt ccttgcggcg gcggtgctca acggcctcaa cctactactg
     ggctgcttcc taatgcagga gtcgcataag ggagagcgtc gaccgatgcc cttgagagcc
     ttcaacccag tcagctcctt ccggtgggcg cggggcatga ctatcgtcgc cgcacttatg
     actgtcttct ttatcatgca actcgtagga caggtgccgg cagcgctctg ggtcattttc
     ggcgaggacc gctttcgctg gagcgcgacg atgatcggcc tgtcgcttgc ggtattcgga
     atcttgcacg ccctcgctca agccttcgtc actggtcccg ccaccaaacg tttcggcgag
     aagcaggcca ttatcgccgg catggcggcc gacgcgctgg gctacgtctt gctggcgttc
     gcgacgcgag gctggatggc cttccccatt atgattcttc tcgcttccgg cggcatcggg
     atgcccgcgt tgcaggccat gctgtccagg caggtagatg acgaccatca gggacagctt
     caaggatcgc tcgcggctct taccagccta acttcgatca ctggaccgct gatcgtcacg
     gcgatttatg ccgcctcggc gagcacatgg aacgggttgg catggattgt aggcgccgcc
     ctataccttg tctgcctccc cgcgttgcgt cgcggtgcat ggagccgggc cacctcgacc
     tgaatggaag ccggcggcac ctcgctaacg gattcaccac tccaagaatt ggagccaatc
     aattcttgcg gagaactgtg aatgcgcaaa ccaacccttg gcagaacata tccatcgcgt
     ccgccatctc cagcagccgc acgcggcgca tcctgttttg gcggatgaga gaagattttc
     agcctgatac agattaaatc agaacgcaga agcggtctga taaaacagaa tttgcctggc
     ggcagtagcg cggtggtccc acctgacccc atgccgaact cagaagtgaa acgccgtagc
     gccgatggta gtgtggggtc tccccatgcg agagtaggga actgccaggc atcaaataaa
     acgaaaggct cagtcgaaag actgggcctt tcgttttatc tgttgtttgt cggtgaacgc
     tctcctgagt aggacaaatc cgccgggagc ggatttgaac gttgcgaagc aacggcccgg
     agggtggcgg gcaggacgcc cgccataaac tgccaggcat caaattaagc agaaggccat
     cctgacggat ggcctttttg cgtttctaca aactcttcct gtcgtcatat ctacaagcca
     tccccccaca gatacggtaa actagcctcg tttttgcatc aggaaagcct gttttggcgg
     atgagagaag attttcagct gatacagatt aaatcagaac gcagaagcgg tctgataaaa
     cagaatttgc ctggcggcag tagcgcggtg gtcccacctg accccatgcc gaactcagaa
     gtgaaacgcc gtagcgccga tggtagtgtg gggtctcccc atgcgagagt agggaactgc
     caggcatcaa ataaaacgaa aggctcagtc gaaagactgg gcctttcgtt ttatctgttg
     tttgtcggtg aacgctctcc tgagtaggac aaatccgccg ggagcggatt tgaacgttgc
     gaagcaacgg cccggagggt ggcgggcagg acgcccgcca taaactgcca ggcatcaaat
     taagcagaag gccatcctga cggatggcct ttttgcgttt ctacaaactc ttcctgtcgt
     catatctaca agccatcccc ccacagatac ggtaaactag cctcgttttt gcatcaggaa
     agcagcgggc agcgttgggt cctggccacg ggtgcgcatg atcgtgctcc tgtcgttgag
     gacccggcta ggctggcggg gttgccttac tggttagcag aatgaatcac cgatacgcga
     gcgaacgtga agcgactgct gctgcaaaac gtctgcgacc tgagcaacaa catgaatggt
     cttcggtttc cgtgtttcgt aaagtctgga aacgcggaag tcagcgccct gcaccattat
     gttccggatc tgcatcgcag gatgctgctg gctaccctgt ggaacaccta catctgtatt
     aacgaagcgc tggcattgac cctgagtgat ttttctctgg tcccgccgca tccataccgc
     cagttgttta ccctcacaac gttccagtaa ccgggcatgt tcatcatcag taacccgtat
     cgtgagcatc ctctctcgtt tcatcggtat cattaccccc atgaacagaa attccccctt
     acacggaggc atcaagtgac caaacaggaa aaaaccgccc ttaacatggc ccgctttatc
     agaagccaga cattaacgct tctggagaaa ctcaacgagc tggacgcgga tgaacaggca
     gacatctgtg aatcgcttca cgaccacgct gatgagcttt accgcagctg cctcgcgcgt
     ttcggtgatg acggtgaaaa cctctgacac atgcagctcc cggagacggt cacagcttgt
     ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg cgtcagcggg tgttggcggg
     tgtcggggcg cagccatgac ccagtcacgt agcgatagcg gagtgtatac tggcttaact
     atgcggcatc agagcagatt gtactgagag tgcaccatat gcggtgtgaa ataccgcaca
     gatgcgtaag gagaaaatac cgcatcaggc gctcttccgc ttcctcgctc actgactcgc
     tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt
     tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg
     ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg
     agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat
     accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta
     ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat agctcacgct
     gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc
     ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa
     gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg
     taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag
     tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt
     gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta
     cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc
     agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa aggatcttca
     cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa
     cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat
     ttcgttcatc catagttgcc tgactccccg tcgtgtagat aactacgata cgggagggct
     taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt
     tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat
     ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta
     atagtttgcg caacgttgtt gccattgctg caggcatcgt ggtgtcacgc tcgtcgtttg
     gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga tcccccatgt
     tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt aagttggccg
     cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc atgccatccg
     taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc
     ggcgaccgag ttgctcttgc ccggcgtcaa cacgggataa taccgcgcca catagcagaa
     ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca aggatcttac
     cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct tcagcatctt
     ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg
     gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa
     gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt tagaaaaata
     aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctgacgtc taagaaacca
     ttattatcat gacattaacc tataaaaata ggcgtatcac gaggcccttt cgtcttcaag
     aattctcatg tttgacagct tatcatcggc tcgtataatg tgtggaattg tgagcggata
     acaatttcac acaggaaaca gcgactgcac ggtgcaccaa tgcttctggc gtcaggcagc
     catcggaagc tgtggtatgg ctgtgcaggt cgtaaatcac tgcataattc gtgtcgctca
     aggcgcactc ccgttctgga taatgttttt tgcgccgaca tcataacggt tctggcaaat
     attctgaaat gagctgttga caattaatca tgataagctt agcttcttg