back Return to this vector's summary.
ID   PTRP56     preliminary; circular DNA; SYN; 6218 BP.
XX
AC   M30890; M29847; ATCC37306;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli plasmid vector pTRP56 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pTRP56 from YRp7 & TRP1 terminator
RC   pA1 from pUC8 & ADC1 gene promoter
RC   pG1 from pUC8 & GAL1 gene promoter
RC   pTRP57 from pTRP56 & CEN3
RC   pcD-Y from pTRP56 & pA1 or pG1
RC   pGAL100 series from pcD-Y
RA   Miyajima A., Nakayama N., Miyajima I., Arai N., Okayama H., Arai K.;
RT   "Analysis of full-length cDNA clones carrying GAL1 gene of
RT   Saccharomyces cerevisiae: a model system for cDNA expression";
RL   Nucleic Acids Res. 12:6397-6414(1984).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   A cloning vector that uses the plasmid primer approach of Okayama &
CC   Berg to allow expression of cDNA clones in yeast.
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pTRP56)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli MC1061)(Saccharomyces cerevisiae)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (YRp7)(yeast TRP5 terminator)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. YRp7 PvuII 5738bp 1999..1999
FT                   KpnI linker 6bp ggtacc
FT                   Tth111I 5740bp 2153..2153, 3' to ori/amp
FT                   2. yeast EcoRI-EcoRI 390bp, TRP5 terminator/polyA
FT                   \ ttcgaagaagacccatctgcctaatgagtaatatctgataaggaacgctt
FT                   \ ttatttagctttttaactacatagacgaatataatatacgatcgggatac
FT                   \ attagcatattcagctcttttacctctcaatttgctcaagattagtatcg
FT                   \ tgaccaattttagatcatttcggtcagaacagccacattttcgcgtaatt
FT                   \ tagaagttcaattattgtatgcgtgacacactatattagcgtcaactgtt
FT                   \ aataaggaagtagtggataataacggttcaggttgcttcacaatgcttat
FT                   \ ttcaaaatctaagatgtttaaaacattttggatactaaccagcatagttc
FT                   \ tcctggcatctgccaccgttgatattagtaaactacaagaattc
FT                   -> pTRP56 6130bp"
FT   -               1..1998
FT                   /note="YRp7 1..1998 1998bp
FT                   PvuII = CAG^CTG
FT                   \           ggtacc"
FT   -               1999..2004
FT                   /note="ggtacc 6bp
FT                   \    ggtacc
FT                   PvuII = CAG^CTG"
FT   -               2005..2159
FT                   /note="YRp7 1999..2153 155bp
FT                   Tth111I = GACN^N NGTC
FT                   \                ttcgaagaa..."
FT   -               2160..2553
FT                   /note="394bp
FT                   \ ttcgaagaagacccatctgcctaatgagtaatatctgataaggaacgctt
FT                   \ ttatttagctttttaactacatagacgaatataatatacgatcgggatac
FT                   \ attagcatattcagctcttttacctctcaatttgctcaagattagtatcg
FT                   \ tgaccaattttagatcatttcggtcagaacagccacattttcgcgtaatt
FT                   \ tagaagttcaattattgtatgcgtgacacactatattagcgtcaactgtt
FT                   \ aataaggaagtagtggataataacggttcaggttgcttcacaatgcttat
FT                   \ ttcaaaatctaagatgtttaaaacattttggatactaaccagcatagttc
FT                   \ tcctggcatctgccaccgttgatattagtaaactacaagaattc
FT                   \    ...gaattc
FT                   Tth111I = GACN^NNGTC"
FT   -               2554..6218
FT                   /note="YRp7 2153..5817 3665bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   promoter        0..0
FT                   /note="PRO yeast ADC1 gene"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   CDS             0..0
FT                   /note="ANT E. coli tetracycline resistance gene (tet)"
FT   CDS             0..0
FT                   /note="ANT yeast TRP1 gene"
XX
SQ   Sequence 6218 BP; 1542 A; 1598 C; 1476 G; 1602 T; 0 other;
     gaattcccac atgttaaaat agtgaaggag catgttcggc acacagtgga ccgaacgtgg
     ggtaagtgca ctagggtccg gttaaacgga tctcgcattg atgaggcaac gctaattatc
     aacatataga ttgttatcta tctgcatgaa cacgaaatct ttacttgacg acttgaggct
     gatggtgttt atgcaaagaa accactgtgt ttaatatgtg tcactgtttg atattactgt
     cagcgtagaa gataatagta aaagcggtta ataagtgtat ttgagataag tgtgataaag
     tttttacagc gaaaagacga taaatacaag aaaatgatta cgaggatacg gagagaggta
     tgtacatgtg tatttatata ctaagctgcc ggcggttgtt tgcaagaccg agaaaaggct
     agcaagaatc gggtcattgt agcgtatgcg cctgtgaaca ttctcttcaa caagtttgat
     tccattgcgg tgaaatggta aaagtcaacc ccctgcgatg tatattttcc tgtacaatca
     atcaaaaagc caaatgattt agcattatct ttacatcttg ttattttaca gattttatgt
     ttagatcttt tatgcttgct tttcaaaagg cctgcaggca agtgcacaaa caatacttaa
     ataaatacta ctcagtaata acctatttct tagcattttt gacgaaattt gctattttgt
     tagagtcttt tacaccattt gtctccacac ctccgcttac atcaacacca ataacgccat
     ttaatctaag cgcatcacca acattttctg gcgtcagtcc accagctaac ataaaatgta
     agctttcggg gctctcttgc cttccaaccc agtcagaaat cgagttccaa tccaaaagtt
     cacctgtccc acctgcttct gaatcaaaca agggaataaa cgaatgaggt ttctgtgaag
     ctgcactgag tagtatgttg cagtcttttg gaaatacgag tcttttaata actggcaaac
     cgaggaactc ttggtattct tgccacgact catctccatg cagttggacg atatcaatgc
     cgtaatcatt gaccagagcc aaaacatcct ccttaggttg attacgaaac acgccaacca
     agtatttcgg agtgcctgaa ctatttttat atgcttttac aagacttgaa attttccttg
     caataaccgg gtcaattgtt ctctttctat tgggcacaca tataataccc agcaagtcag
     catcggaatc tagagcacat tctgcggcct ctgtgctctg caagccgcaa actttcacca
     atggaccaga actacctgtg aaattaataa cagacatact ccaagctgcc tttgtgtgct
     taatcacgta tactcacgtg ctcaatagtc accaatgccc tccctcttgg ccctctcctt
     ttcttttttc gaccgaattc tcatgtttga cagcttatca tcgataagct ttaatgcggt
     agtttatcac agttaaattg ctaacgcagt caggcaccgt gtatgaaatc taacaatgcg
     ctcatcgtca tcctcggcac cgtcaccctg gatgctgtag gcataggctt ggttatgccg
     gtactgccgg gcctcttgcg ggatatcgtc cattccgaca gcatcgccag tcactatggc
     gtgctgctag cgctatatgc gttgatgcaa tttctatgcg cacccgttct cggagcactg
     tccgaccgct ttggccgccg cccagtcctg ctcgcttcgc tacttggagc cactatcgac
     tacgcgatca tggcgaccac acccgtcctg tggatcctct acgccggacg catcgtggcc
     ggcatcaccg gcgccacagg tgcggttgct ggcgcctata tcgccgacat caccgatggg
     gaagatcggg ctcgccactt cgggctcatg agcgcttgtt tcggcgtggg tatggtggca
     ggccccgtgg ccgggggagg taccctgttg ggcgccatct ccttgcatgc accattcctt
     gcggcggcgg tgctcaacgg cctcaaccta ctactgggct gcttcctaat gcaggagtcg
     cataagggag agcgtcgacc gatgcccttg agagccttca acccagtcag ctccttccgt
     tcgaagaaga cccatctgcc taatgagtaa tatctgataa ggaacgcttt tatttagctt
     tttaactaca tagacgaata taatatacga tcgggataca ttagcatatt cagctctttt
     acctctcaat ttgctcaaga ttagtatcgt gaccaatttt agatcatttc ggtcagaaca
     gccacatttt cgcgtaattt agaagttcaa ttattgtatg cgtgacacac tatattagcg
     tcaactgtta ataaggaagt agtggataat aacggttcag gttgcttcac aatgcttatt
     tcaaaatcta agatgtttaa aacattttgg atactaacca gcatagttct cctggcatct
     gccaccgttg atattagtaa actacaagaa ttcggtgggc gcggggcatg actatcgtcg
     ccgcacttat gactgtcttc tttatcatgc aactcgtagg acaggtgccg gcagcgctct
     gggtcatttt cggcgaggac cgctttcgct ggagcgcgac gatgatcggc ctgtcgcttg
     cggtattcgg aatcttgcac gccctcgctc aagccttcgt cactggtccc gccaccaaac
     gtttcggcga gaagcaggcc attatcgccg gcatggcggc cgacgcgctg ggctacgtct
     tgctggcgtt cgcgacgcga ggctggatgg ccttccccat tatgattctt ctcgcttccg
     gcggcatcgg gatgcccgcg ttgcaggcca tgctgtccag gcaggtagat gacgaccatc
     agggacagct tcaaggatcg ctcgcggctc ttaccagcct aacttcgatc actggaccgc
     tgatcgtcac ggcgatttat gccgcctcgg cgagcacatg gaacgggttg gcatggattg
     taggcgccgc cctatacctt gtctgcctcc ccgcgttgcg tcgcggtgca tggagccggg
     ccacctcgac ctgaatggaa gccggcggca cctcgctaac ggattcacca ctccaagaat
     tggagccaat caattcttgc ggagaactgt gaatgcgcaa accaaccctt ggcagaacat
     atccatcgcg tccgccatct ccagcagccg cacgcggcgc atctcgggca gcgttgggtc
     ctggccacgg gtgcgcatga tcgtgctcct gtcgttgagg acccggctag gctggcgggg
     ttgccttact ggttagcaga atgaatcacc gatacgcgag cgaacgtgaa gcgactgctg
     ctgcaaaacg tctgcgacct gagcaacaac atgaatggtc ttcggtttcc gtgtttcgta
     aagtctggaa acgcggaagt cagcgccctg caccattatg ttccggatct gcatcgcagg
     atgctgctgg ctaccctgtg gaacacctac atctgtatta acgaagcgct ggcattgacc
     ctgagtgatt tttctctggt cccgccgcat ccataccgcc agttgtttac cctcacaacg
     ttccagtaac cgggcatgtt catcatcagt aacccgtatc gtgagcatcc tctctcgttt
     catcggtatc attaccccca tgaacagaaa ttccccctta cacggaggca tcaagtgacc
     aaacaggaaa aaaccgccct taacatggcc cgctttatca gaagccagac attaacgctt
     ctggagaaac tcaacgagct ggacgcggat gaacaggcag acatctgtga atcgcttcac
     gaccacgctg atgagcttta ccgcagctgc ctcgcgcgtt tcggtgatga cggtgaaaac
     ctctgacaca tgcagctccc ggagacggtc acagcttgtc tgtaagcgga tgccgggagc
     agacaagccc gtcagggcgc gtcagcgggt gttggcgggt gtcggggcgc agccatgacc
     cagtcacgta gcgatagcgg agtgtatact ggcttaacta tgcggcatca gagcagattg
     tactgagagt gcaccatatg cggtgtgaaa taccgcacag atgcgtaagg agaaaatacc
     gcatcaggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc
     ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata
     acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg
     cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct
     caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa
     gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc
     tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc agttcggtgt
     aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg
     ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg
     cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct
     tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc
     tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg
     ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc
     aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt
     aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa
     aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac agttaccaat
     gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc atagttgcct
     gactccccgt cgtgtagata actacgatac gggagggctt accatctggc cccagtgctg
     caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata aaccagccag
     ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc cagtctatta
     attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg
     ccattgctgc aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg
     gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa gcggttagct
     ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca ctcatggtta
     tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt tctgtgactg
     gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc
     cggcgtcaac acgggataat accgcgccac atagcagaac tttaaaagtg ctcatcattg
     gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga tccagttcga
     tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc agcgtttctg
     ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg acacggaaat
     gttgaatact catactcttc ctttttcaat attattgaag catttatcag ggttattgtc
     tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg gttccgcgca
     catttccccg aaaagtgcca cctgacgtct aagaaaccat tattatcatg acattaacct
     ataaaaatag gcgtatcacg aggccctttc gtcttcaa
//