back Return to this vector's summary.
ID   PTZ18R     preliminary; circular DNA; SYN; 2861 BP.
XX
AC   IG0103; L08956; VB0071;
XX
DT   02-NOV-1992 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli phagemid vector pTZ18R - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pZf18R from pUC18 & pDM1, f1
RC   pZf18U from pUC18 & pDM1, f1
RC   pZf19R from pUC19 & pDM1, f1
RC   pZf19U from pUC19 & pDM1, f1
RC   pTZ18R from pZf18R & oligo, T7 promoter
RC   pTZ18U from pZf18U & oligo, T7 promoter
RC   pTZ19R from pZf19R & oligo, T7 promoter
RC   pTZ19U from pZf19U & oligo, T7 promoter
RC   pTP6 from pSP64-f1- & pTZ19R
RC   pC2A from pTZ18R & pP-450PBc2
RA   Mead D.A., Szczesna-Skorupa E., Kemper B.;
RT   "Single-stranded DNA blue T7 promoter plasmids: a versatile
RT   tandem promoter system for cloning and protein engineering";
RL   Protein Engineering 1:67-74(1986).
XX
RN   [2]
RC   D45-2 from Sm-D gene
RC   from pTZ19R & D45-2, Sm-D gene
RA   Rokeach L.A., Haselby J.A., Hoch S.O.;
RT   "Molecular cloning of a cDNA encoding the human Sm-D autoantigen";
RL   Proc. Natl. Acad. Sci. U.S.A. 85:4832-4836(1988).
XX
RN   [3]
RP   1-2871
RC   pTZ18R
RA   Gilbert W.;
RT   "Obtained from VecBase 3.0";
RL   Unpublished (1991).
XX
RN   [4]
RC   pP-450PBc1, pP-450PBc2, pP-450PBc3 from pBR322 & rabbit P-450 gene
RA   Leighton J.K., DeBrunner-Vossbrink B.A., Kemper B.;
RT   "Isolation and sequence analysis of three cloned cDNAs for rabbit
RT   liver proteins that are related to rabbit cytochrome P-450 (form
RT   2), the major phenobarbital-inducible form";
RL   Biochemistry 23:204-210(1984).
XX
CC   USB sequence is 2860 bp and is provided as the inverse complement of
CC   this entry's sequence; it starts at position 2389 of this entry.
CC   USB differs at position 1095: USB is G & Pharmacia is A.
CC   USB differs at position 2563: USB is C & Pharmacia is A.
CC   USB differs at position 2849: Pharmacia inserts an A.
CC   pTZ18R requires a reverse primer.
CC   GenBank entry is not current with Pharmacia entry (1993).
CC   NM (pTZ18R)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST (non-coding)
CC   TY (phagemid)
CC   SP (Pharmacia)(Sigma)(USB)
CC   HO (E.coli JM103)(E.coli NM522)
CC   CP ()
CC   FN (cloning)(sequencing)(mutagenesis)(transcription)
CC   SE (color blue/white)
CC   PA (pUC18)(f1)(pDM1)
CC   BR (pTZ18U)(pTZ19U)(pTZ19R)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC18 remove AatII-NarI 301bp
FT                   \ 2622..2686..237, 2367bp
FT                   mung bean nuclease
FT                   2. pDM1 DraI-HincII 456bp, f1 ori
FT                   mung bean nuclease
FT                   -> pZf18R 2823bp
FT                   1. pZf18R EcoRI 2823bp 451..451
FT                   fill in
FT                   2. oligo 20bp taatacgactcactataggg, T7 promoter
FT                   -> pTZ18R 2861bp"
FT   promoter        1..216
FT                   /note="PRO E. coli lac gene"
FT   CDS             217..471
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ)
FT                   alpha peptide"
FT   promoter        236..252
FT                   /note="PRO bacteriophage T7"
FT   misc_binding    255..306
FT                   /note="MCS EcoRI-SacI-KpnI-SmaI-BamHI-XbaI-SalI-
FT                   BspMI-PstI-SphI-HindIII"
FT   rep_origin      473..928
FT                   /note="ORI bacteriophage f1 intergenic region"
FT   misc_binding    2530..2530
FT                   /note="SIT unique NaeI"
FT   CDS             1061..1920
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   misc_binding    1964..1964
FT                   /note="SIT unique ScaI"
FT   misc_binding    2022..2022
FT                   /note="SIT unique AhaII"
FT   misc_binding    2081..2081
FT                   /note="SIT unique XmnI"
FT   rep_origin      2615..2615
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 2861 BP; 693 A; 730 C; 696 G; 742 T; 0 other;
     cccattcgcc attcaggctg cgcaactgtt gggaagggcg atcggtgcgg gcctcttcgc
     tattacgcca gctggcgaaa gggggatgtg ctgcaaggcg attaagttgg gtaacgccag
     ggttttccca gtcacgacgt tgtaaaacga cggccagtgc caagcttgca tgcctgcagg
     tcgactctag aggatccccg ggtaccgagc tcgaattccc tatagtgagt cgtattaaat
     tcgtaatcat ggtcatagct gtttcctgtg tgaaattgtt atccgctcac aattccacac
     aacatacgag ccggaagcat aaagtgtaaa gcctggggtg cctaatgagt gagctaactc
     acattaattg cgttgcgctc actgcccgct ttccagtcgg gaaacctgtc gtgccagctg
     cattaatgaa tcggccaacg cgcggggaga ggcggtttgc gtattgggcg ctcttccgct
     tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac
     tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga
     gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat
     aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac
     ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct
     gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg
     ctttctcaat gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg
     ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt
     cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg
     attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac
     ggctacacta gaagaacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga
     aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggttttttt
     gtttgcaagc agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt
     tctacggggt ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaga
     ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa aatgaagttt taaatcaatc
     taaagtatat atgagtaaac ttggtctgac agttaccaat gcttaatcag tgaggcacct
     atctcagcga tctgtctatt tcgttcatcc atagttgcct gactccccgt cgtgtagata
     actacgatac gggagggctt accatctggc cccagtgctg caatgatacc gcgagaccca
     cgctcaccgg ctccagattt atcagcaata aaccagccag ccggaagggc cgagcgcaga
     agtggtcctg caactttatc cgcctccatc cagtctatta attgttgccg ggaagctaga
     gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg ccattgctac aggcatcgtg
     gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg gttcccaacg atcaaggcga
     gttacatgat cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt
     gtcagaagta agttggccgc agtgttatca ctcatggtta tggcagcact gcataattct
     cttactgtca tgccatccgt aagatgcttt tctgtgactg gtgagtactc aaccaagtca
     ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaat acgggataat
     accgcgccac atagcagaac tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga
     aaactctcaa ggatcttacc gctgttgaga tccagttcga tgtaacccac tcgtgcaccc
     aactgatctt cagcatcttt tactttcacc agcgtttctg ggtgagcaaa aacaggaagg
     caaaatgccg caaaaaaggg aataagggcg acacggaaat gttgaatact catactcttc
     ctttttcaat attattgaag catttatcag ggttattgtc tcatgagcgg atacatattt
     gaatgtattt agaaaaataa acaaataggg gttccgcgca catttccccg aaaagtgcca
     cctgacgcgc cctgtagcgg cgcattaagc gcggcgggtg tggtggttac gcgcagcgtg
     accgctacac ttgccagcgc cctagcgccc gctcctttcg ctttcttccc ttcctttctc
     gccacgttcg ccggctttcc ccgtcaagct ctaaatcggg gcatcccttt agggttccga
     tttagtgctt tacggcacct cgaccccaaa aaacttgatt agggtgatgg ttcacgtagt
     gggccatcgc cctgatagac ggtttttcgc cctttgacgt tggagtccac gttctttaat
     agtggactct tgttccaaac tggaacaaca ctcaacccta tctcggtcta ttcttttgat
     ttataaggga ttttgccgat ttcggcctat tggttaaaaa atgagctgat ttaacaaaaa
     tttaacgcga attttaacaa aatattaaac gtttacaatt t
//