back Return to this vector's summary.
ID   PTZ18U     preliminary; circular DNA; SYN; 2860 BP.
XX
AC   IG0104;
XX
DT   02-NOV-1992 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli phagemid vector pTZ18U - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pZf18R from pUC18 & pDM1, f1
RC   pZf18U from pUC18 & pDM1, f1
RC   pZf19R from pUC19 & pDM1, f1
RC   pZf19U from pUC19 & pDM1, f1
RC   pTZ18R from pZf18R & oligo, T7 promoter
RC   pTZ18U from pZf18U & oligo, T7 promoter
RC   pTZ19R from pZf19R & oligo, T7 promoter
RC   pTZ19U from pZf19U & oligo, T7 promoter
RC   pTP6 from pSP64-f1- & pTZ19R
RC   pC2A from pTZ18R & pP-450PBc2
RA   Mead D.A., Szczesna-Skorupa E., Kemper B.;
RT   "Single-stranded DNA blue T7 promoter plasmids: a versatile
RT   tandem promoter system for cloning and protein engineering";
RL   Protein Engineering 1:67-74(1986).
XX
CC   pTZ18U requires a reverse primer.
CC   NM (pTZ18U)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST (coding)
CC   TY (phagemid)
CC   SP (Bio-Rad)(Sigma)(USB)
CC   HO (E.coli JM103)(E.coli CJ236)(E.coli NM522)
CC   CP ()
CC   FN (cloning)(sequencing)(mutagenesis)(transcription)
CC   SE (color blue/white)
CC   PA (pUC18)(f1)(pDM1)
CC   BR (pTZ18R)(pTZ19U)(pTZ19R)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC18 remove AatII-NarI 301bp
FT                   \ 2622..2686..237, 2367bp
FT                   mung bean nuclease
FT                   2. pDM1 DraI-HincII 456bp, f1 ori
FT                   mung bean nuclease
FT                   -> pZf18U 2823bp
FT                   1. pZf18U EcoRI 2823bp 451..451
FT                   fill in
FT                   2. oligo 20bp taatacgactcactataggg, T7 promoter
FT                   -> pTZ18U 2860bp"
FT   promoter        1..216
FT                   /note="PRO E. coli lac gene"
FT   CDS             217..471
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ)
FT                   alpha peptide"
FT   promoter        236..252
FT                   /note="PRO bacteriophage T7"
FT   misc_binding    255..306
FT                   /note="MCS EcoRI-SacI-KpnI-SmaI-BamHI-XbaI-SalI-
FT                   BspMI-PstI-SphI-HindIII"
FT   rep_origin      473..928
FT                   /note="ORI bacteriophage f1"
FT   misc_binding    2530..2530
FT                   /note="SIT unique NaeI"
FT   CDS             1061..1920
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   misc_binding    1964..1964
FT                   /note="SIT unique ScaI"
FT   misc_binding    2022..2022
FT                   /note="SIT unique AhaII"
FT   misc_binding    2081..2081
FT                   /note="SIT unique XmnI"
FT   rep_origin      2615..2615
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 2860 BP; 700 A; 718 C; 710 G; 732 T; 0 other;
     agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc
     acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc
     tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa
     ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac gaatttaata
     cgactcacta tagggaattc gagctcggta cccggggatc ctctagagtc gacctgcagg
     catgcaagct tggcactggc cgtcgtttta caacgtcgtg actgggaaaa ccctggcgtt
     acccaactta atcgccttgc agcacatccc cctttcgcca gctggcgtaa tagcgaagag
     gcccgcaccg atcgcccttc ccaacagttg cgcagcctga atggcgaatg ggacgcgccc
     tgtagcggcg cattaagcgc ggcgggtgtg gtggttacgc gcagcgtgac cgctacactt
     gccagcgccc tagcgcccgc tcctttcgct ttcttccctt cctttctcgc cacgttcgcc
     ggctttcccc gtcaagctct aaatcggggg ctccctttag ggttccgatt tagtgcttta
     cggcacctcg accccaaaaa acttgattag ggtgatggtt cacgtagtgg gccatcgccc
     tgatagacgg tttttcgccc tttgacgttg gagtccacgt tctttaatag tggactcttg
     ttccaaactg gaacaacact caaccctatc tcggtctatt cttttgattt ataagggatt
     ttgccgattt cggcctattg gttaaaaaat gagctgattt aacaaaaatt taacgcgaat
     tttaacaaaa tattaacgtt tacaatttca ggtggcactt ttcggggaaa tgtgcgcgga
     acccctattt gtttattttt ctaaatacat tcaaatatgt atccgctcat gagacaataa
     ccctgataaa tgcttcaata atattgaaaa aggaagagta tgagtattca acatttccgt
     gtcgccctta ttcccttttt tgcggcattt tgccttcctg tttttgctca cccagaaacg
     ctggtgaaag taaaagatgc tgaagatcag ttgggtgcac gagtgggtta catcgaactg
     gatctcaaca gcggtaagat ccttgagagt tttcgccccg aagaacgttt tccaatgatg
     agcactttta aagttctgct atgtggcgcg gtattatccc gtattgacgc cgggcaagag
     caactcggtc gccgcataca ctattctcag aatgacttgg ttgagtactc accagtcaca
     gaaaagcatc ttacggatgg catgacagta agagaattat gcagtgctgc cataaccatg
     agtgataaca ctgcggccaa cttacttctg acaacgatcg gaggaccgaa ggagctaacc
     gcttttttgc acaacatggg ggatcatgta actcgccttg atcgttggga accggagctg
     aatgaagcca taccaaacga cgagcgtgac accacgatgc ctgtagcaat ggcaacaacg
     ttgcgcaaac tattaactgg cgaactactt actctagctt cccggcaaca attaatagac
     tggatggagg cggataaagt tgcaggacca cttctgcgct cggcccttcc ggctggctgg
     tttattgctg ataaatctgg agccggtgag cgtgggtctc gcggtatcat tgcagcactg
     gggccagatg gtaagccctc ccgtatcgta gttatctaca cgacggggag tcaggcaact
     atggatgaac gaaatagaca gatcgctgag ataggtgcct cactgattaa gcattggtaa
     ctgtcagacc aagtttactc atatatactt tagattgatt taaaacttca tttttaattt
     aaaaggatct aggtgaagat cctttttgat aatctcatga ccaaaatccc ttaacgtgag
     ttttcgttcc actgagcgtc agaccccgta gaaaagatca aaggatcttc ttgagatcct
     ttttttctgc gcgtaatctg ctgcttgcaa acaaaaaaac caccgctacc agcggtggtt
     tgtttgccgg atcaagagct accaactctt tttccgaagg taactggctt cagcagagcg
     cagataccaa atactgtcct tctagtgtag ccgtagttag gccaccactt caagaactct
     gtagcaccgc ctacatacct cgctctgcta atcctgttac cagtggctgc tgccagtggc
     gataagtcgt gtcttaccgg gttggactca agacgatagt taccggataa ggcgcagcgg
     tcgggctgaa cggggggttc gtgcacacag cccagcttgg agcgaacgac ctacaccgaa
     ctgagatacc tacagcgtga gcattgagaa agcgccacgc ttcccgaagg gagaaaggcg
     gacaggtatc cggtaagcgg cagggtcgga acaggagagc gcacgaggga gcttccaggg
     ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc acctctgact tgagcgtcga
     tttttgtgat gctcgtcagg ggggcggagc ctatggaaaa acgccagcaa cgcggccttt
     ttacggttcc tggccttttg ctggcctttt gctcacatgt tctttcctgc gttatcccct
     gattctgtgg ataaccgtat taccgccttt gagtgagctg ataccgctcg ccgcagccga
     acgaccgagc gcagcgagtc agtgagcgag gaagcggaag
//