back Return to this vector's summary.
ID   PTZ19R     preliminary; circular DNA; SYN; 2863 BP.
XX
AC   IG0105; L08957; VB0110;
XX
DT   02-NOV-1992 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli phagemid vector pTZ19R - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pZf18R from pUC18 & pDM1, f1
RC   pZf18U from pUC18 & pDM1, f1
RC   pZf19R from pUC19 & pDM1, f1
RC   pZf19U from pUC19 & pDM1, f1
RC   pTZ18R from pZf18R & oligo, T7 promoter
RC   pTZ18U from pZf18U & oligo, T7 promoter
RC   pTZ19R from pZf19R & oligo, T7 promoter
RC   pTZ19U from pZf19U & oligo, T7 promoter
RC   pTP6 from pSP64-f1- & pTZ19R
RC   pC2A from pTZ18R & pP-450PBc2
RA   Mead D.A., Szczesna-Skorupa E., Kemper B.;
RT   "Single-stranded DNA blue T7 promoter plasmids: a versatile
RT   tandem promoter system for cloning and protein engineering";
RL   Protein Engineering 1:67-74(1986).
XX
RN   [2]
RP   1-2870
RC   pTZ19R
RA   Gilbert W.;
RT   "Obtained from VecBase 3.0";
RL   Unpublished (1991).
XX
CC   pTZ19R requires a reverse primer.
CC   USB sequence is 2863 bp and is provided as the inverse complement of
CC   this entry's sequence; it starts at position 2386 of this entry.
CC   pTZ18R requires a reverse primer.
CC   GenBank entry is not current with Pharmacia entry (1993).
CC   NM (pTZ19R)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST (non-coding)
CC   TY (phagemid)
CC   SP (Pharmacia)(Sigma)(USB)
CC   HO (E.coli JM103)(E.coli NM522)
CC   CP ()
CC   FN (cloning)(sequencing)(mutagenesis)(transcription)
CC   SE (color blue/white)
CC   PA (pUC19)(f1)(pDM1)
CC   BR (pTZ18U)(pTZ19U)(pTZ18R)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC19 remove NarI-AatII 2385bp 237..2622
FT                   mung bean nuclease
FT                   2. pDM1 DraI-HincII 456bp, f1 ori
FT                   mung bean nuclease
FT                   -> pZf19R 2841bp
FT                   1. pZf19R HindIII 2841bp
FT                   fill in
FT                   2. oligo 23bp ctaatacgactcactatagggaa, T7 promoter
FT                   -> pTZ19R 2863bp"
FT   promoter        1..216
FT                   /note="PRO E. coli lac gene"
FT   CDS             217..470
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ)
FT                   alpha peptide"
FT   promoter        236..252
FT                   /note="PRO bacteriophage T7"
FT   misc_binding    255..306
FT                   /note="MCS HindIII-SphI-PstI-BspMI-SalI-XbaI-
FT                   BamHI-SmaI-KpnI-SacI-EcoRI"
FT   rep_origin      472..927
FT                   /note="ORI bacteriophage f1 intergenic region"
FT   misc_binding    2533..2533
FT                   /note="SIT unique NaeI"
FT   CDS             1060..1919
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   misc_binding    1967..1967
FT                   /note="SIT unique ScaI"
FT   misc_binding    2025..2025
FT                   /note="SIT unique AhaII"
FT   misc_binding    2084..2084
FT                   /note="SIT unique XmnI"
FT   rep_origin      2613..2613
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 2863 BP; 691 A; 729 C; 700 G; 743 T; 0 other;
     cccattcgcc attcaggctg cgcaactgtt gggaagggcg atcggtgcgg gcctcttcgc
     tattacgcca gctggcgaaa gggggatgtg ctgcaaggcg attaagttgg gtaacgccag
     ggttttccca gtcacgacgt tgtaaaacga cggccagtga attcgagctc ggtacccggg
     gatcctctag agtcgacctg caggcatgca agctttccct atagtgagtc gtattagagc
     ttggcgtaat catggtcata gctgtttcct gtgtgaaatt gttatccgct cacaattcca
     cacaacatac gagccggaag cataaagtgt aaagcctggg gtgcctaatg agtgagctaa
     ctcacattaa ttgcgttgcg ctcactgccc gctttccagt cgggaaacct gtcgtgccag
     ctgcattaat gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc
     gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct
     cactcaaagg cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg
     tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc
     cataggctcc gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga
     aacccgacag gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct
     cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg
     gcgctttctc aatgctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag
     ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat
     cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac
     aggattagca gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac
     tacggctaca ctagaagaac agtatttggt atctgcgctc tgctgaagcc agttaccttc
     ggaaaaagag ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt
     tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc
     ttttctacgg ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg
     agattatcaa aaaggatctt cacctagatc cttttaaatt aaaaatgaag ttttaaatca
     atctaaagta tatatgagta aacttggtct gacagttacc aatgcttaat cagtgaggca
     cctatctcag cgatctgtct atttcgttca tccatagttg cctgactccc cgtcgtgtag
     ataactacga tacgggaggg cttaccatct ggccccagtg ctgcaatgat accgcgagac
     ccacgctcac cggctccaga tttatcagca ataaaccagc cagccggaag ggccgagcgc
     agaagtggtc ctgcaacttt atccgcctcc atccagtcta ttaattgttg ccgggaagct
     agagtaagta gttcgccagt taatagtttg cgcaacgttg ttgccattgc tacaggcatc
     gtggtgtcac gctcgtcgtt tggtatggct tcattcagct ccggttccca acgatcaagg
     cgagttacat gatcccccat gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc
     gttgtcagaa gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat
     tctcttactg tcatgccatc cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag
     tcattctgag aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aatacgggat
     aataccgcgc cacatagcag aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg
     cgaaaactct caaggatctt accgctgttg agatccagtt cgatgtaacc cactcgtgca
     cccaactgat cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga
     aggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc
     ttcctttttc aatattattg aagcatttat cagggttatt gtctcatgag cggatacata
     tttgaatgta tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtg
     ccacctgacg cgccctgtag cggcgcatta agcgcggcgg gtgtggtggt tacgcgcagc
     gtgaccgcta cacttgccag cgccctagcg cccgctcctt tcgctttctt cccttccttt
     ctcgccacgt tcgccggctt tccccgtcaa gctctaaatc ggggcatccc tttagggttc
     cgatttagtg ctttacggca cctcgacccc aaaaaacttg attagggtga tggttcacgt
     agtgggccat cgccctgata gacggttttt cgccctttga cgttggagtc cacgttcttt
     aatagtggac tcttgttcca aactggaaca acactcaacc ctatctcggt ctattctttt
     gatttataag ggattttgcc gatttcggcc tattggttaa aaaatgagct gatttaacaa
     aaatttaacg cgaattttaa caaaatatta acgtttacaa ttt
//