back Return to this vector's summary.
ID   PTZ19U     preliminary; circular DNA; SYN; 2863 BP.
XX
AC   IG0106;
XX
DT   02-NOV-1992 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli phagemid vector pTZ19U - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pZf18R from pUC18 & pDM1, f1
RC   pZf18U from pUC18 & pDM1, f1
RC   pZf19R from pUC19 & pDM1, f1
RC   pZf19U from pUC19 & pDM1, f1
RC   pTZ18R from pZf18R & oligo, T7 promoter
RC   pTZ18U from pZf18U & oligo, T7 promoter
RC   pTZ19R from pZf19R & oligo, T7 promoter
RC   pTZ19U from pZf19U & oligo, T7 promoter
RC   pTP6 from pSP64-f1- & pTZ19R
RC   pC2A from pTZ18R & pP-450PBc2
RA   Mead D.A., Szczesna-Skorupa E., Kemper B.;
RT   "Single-stranded DNA blue T7 promoter plasmids: a versatile
RT   tandem promoter system for cloning and protein engineering";
RL   Protein Engineering 1:67-74(1986).
XX
CC   pTZ19U requires a reverse primer.
CC   NM (pTZ19U)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST (coding)
CC   TY (phagemid)
CC   SP (Bio-Rad)(Sigma)(USB)
CC   HO (E.coli JM103)(E.coli CJ236)(E.coli NM522)
CC   CP ()
CC   FN (cloning)(sequencing)(mutagenesis)(transcription)
CC   SE (color blue/white)
CC   PA (pUC19)(f1)(pDM1)
CC   BR (pTZ18U)(pTZ19R)(pTZ18R)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC19 remove NarI-AatII 2385bp 237..2622
FT                   mung bean nuclease
FT                   2. pDM1 DraI-HincII 456bp, f1 ori
FT                   mung bean nuclease
FT                   -> pZf19U 2841bp
FT                   1. pZf19U HindIII 2841bp
FT                   fill in
FT                   2. oligo 23bp ctaatacgactcactatagggaa, T7 promoter
FT                   -> pTZ19U 2863bp"
FT   promoter        1..216
FT                   /note="PRO E. coli lac gene"
FT   CDS             217..470
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ)
FT                   alpha peptide"
FT   promoter        236..252
FT                   /note="PRO bacteriophage T7"
FT   misc_binding    255..306
FT                   /note="MCS HindIII-SphI-PstI-BspMI-SalI-XbaI-
FT                   BamHI-SmaI-KpnI-SacI-EcoRI"
FT   rep_origin      472..927
FT                   /note="ORI bacteriophage f1"
FT   misc_binding    2533..2533
FT                   /note="SIT unique NaeI"
FT   CDS             1061..1920
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   misc_binding    1967..1967
FT                   /note="SIT unique ScaI"
FT   misc_binding    2025..2025
FT                   /note="SIT unique AhaII"
FT   misc_binding    2084..2084
FT                   /note="SIT unique XmnI"
FT   rep_origin      2613..2613
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 2863 BP; 701 A; 722 C; 709 G; 731 T; 0 other;
     agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc
     acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc
     tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa
     ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac gccaagctct
     aatacgactc actataggga aagcttgcat gcctgcaggt cgactctaga ggatccccgg
     gtaccgagct cgaattcact ggccgtcgtt ttacaacgtc gtgactggga aaaccctggc
     gttacccaac ttaatcgcct tgcagcacat ccccctttcg ccagctggcg taatagcgaa
     gaggcccgca ccgatcgccc ttcccaacag ttgcgcagcc tgaatggcga atgggacgcg
     ccctgtagcg gcgcattaag cgcggcgggt gtggtggtta cgcgcagcgt gaccgctaca
     cttgccagcg ccctagcgcc cgctcctttc gctttcttcc cttcctttct cgccacgttc
     gccggctttc cccgtcaagc tctaaatcgg gggctccctt tagggttccg atttagtgct
     ttacggcacc tcgaccccaa aaaacttgat tagggtgatg gttcacgtag tgggccatcg
     ccctgataga cggtttttcg ccctttgacg ttggagtcca cgttctttaa tagtggactc
     ttgttccaaa ctggaacaac actcaaccct atctcggtct attcttttga tttataaggg
     attttgccga tttcggccta ttggttaaaa aatgagctga tttaacaaaa atttaacgcg
     aattttaaca aaatattaac gtttacaatt tcaggtggca cttttcgggg aaatgtgcgc
     ggaaccccta tttgtttatt tttctaaata cattcaaata tgtatccgct catgagacaa
     taaccctgat aaatgcttca ataatattga aaaaggaaga gtatgagtat tcaacatttc
     cgtgtcgccc ttattccctt ttttgcggca ttttgccttc ctgtttttgc tcacccagaa
     acgctggtga aagtaaaaga tgctgaagat cagttgggtg cacgagtggg ttacatcgaa
     ctggatctca acagcggtaa gatccttgag agttttcgcc ccgaagaacg ttttccaatg
     atgagcactt ttaaagttct gctatgtggc gcggtattat cccgtattga cgccgggcaa
     gagcaactcg gtcgccgcat acactattct cagaatgact tggttgagta ctcaccagtc
     acagaaaagc atcttacgga tggcatgaca gtaagagaat tatgcagtgc tgccataacc
     atgagtgata acactgcggc caacttactt ctgacaacga tcggaggacc gaaggagcta
     accgcttttt tgcacaacat gggggatcat gtaactcgcc ttgatcgttg ggaaccggag
     ctgaatgaag ccataccaaa cgacgagcgt gacaccacga tgcctgtagc aatggcaaca
     acgttgcgca aactattaac tggcgaacta cttactctag cttcccggca acaattaata
     gactggatgg aggcggataa agttgcagga ccacttctgc gctcggccct tccggctggc
     tggtttattg ctgataaatc tggagccggt gagcgtgggt ctcgcggtat cattgcagca
     ctggggccag atggtaagcc ctcccgtatc gtagttatct acacgacggg gagtcaggca
     actatggatg aacgaaatag acagatcgct gagataggtg cctcactgat taagcattgg
     taactgtcag accaagttta ctcatatata ctttagattg atttaaaact tcatttttaa
     tttaaaagga tctaggtgaa gatccttttt gataatctca tgaccaaaat cccttaacgt
     gagttttcgt tccactgagc gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat
     cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa aaccaccgct accagcggtg
     gtttgtttgc cggatcaaga gctaccaact ctttttccga aggtaactgg cttcagcaga
     gcgcagatac caaatactgt ccttctagtg tagccgtagt taggccacca cttcaagaac
     tctgtagcac cgcctacata cctcgctctg ctaatcctgt taccagtggc tgctgccagt
     ggcgataagt cgtgtcttac cgggttggac tcaagacgat agttaccgga taaggcgcag
     cggtcgggct gaacgggggg ttcgtgcaca cagcccagct tggagcgaac gacctacacc
     gaactgagat acctacagcg tgagcattga gaaagcgcca cgcttcccga agggagaaag
     gcggacaggt atccggtaag cggcagggtc ggaacaggag agcgcacgag ggagcttcca
     gggggaaacg cctggtatct ttatagtcct gtcgggtttc gccacctctg acttgagcgt
     cgatttttgt gatgctcgtc aggggggcgg agcctatgga aaaacgccag caacgcggcc
     tttttacggt tcctggcctt ttgctggcct tttgctcaca tgttctttcc tgcgttatcc
     cctgattctg tggataaccg tattaccgcc tttgagtgag ctgataccgc tcgccgcagc
     cgaacgaccg agcgcagcga gtcagtgagc gaggaagcgg aag
//