back Return to this vector's summary.
ID   PUC28      preliminary; circular DNA; SYN; 2758 BP.
XX
AC   IG6005;
XX
DT   02-NOV-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pUC28 - complete, MCS.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pUC28 from pUC18 & oligo
RC   pUC29 from pUC19 & oligo
RC   M13mp28 from M13mp18 & oligo
RC   M13mp29 from M13mp19 & oligo
RC   M13mpEH from M13 & oligo
RC   M13mpHE from M13 & oligo
RA   Benes V., Hostomsky Z., Arnold L., Paces V.;
RT   "M13 and pUC vectors with new unique restriction sites for cloning";
RL   Gene 130:151-152(1993).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   NM (pUC28)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pUC18)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC18 remove HindIII-EcoRI 51bp 400..451,
FT                   \ MCS/2635bp
FT                   2. oligo EcoRI-HindIII 132bp
FT                   \ gaattcgcgagctccatggatatcgatcgcatgcatatgggccctcgagg
FT                   \ ccttgaatgcggccgcggtacccggggatcctctagagtcgacctgcagg
FT                   \ cgccacgcgtacgtgcacgacgtcttaagctt
FT                   -> pUC28 2767bp"
FT   -               1..399
FT                   /note="pUC18 1..399 399bp
FT                   HindIII = A^AGCTT
FT                   \           agctt..."
FT   -               400..522
FT                   /note="123bp
FT                   \ agcttaagacgtcgtcgtacgcgtggcgcctgcaggtcgactctagagg
FT                   \ atccccgggtaccgcggccgcattcaaggcctcgagggcccatatgcatg
FT                   \ cgatcgatatccatggagctcgcg
FT                   \ ...tcgcg
FT                   EcoRI =  G^AATTC"
FT   -               523..2758
FT                   /note="pUC18 451..2686 2236bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 2758 BP; 682 A; 699 C; 706 G; 671 T; 0 other;
     tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
     accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc
     attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat
     tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt
     tttcccagtc acgacgttgt aaaacgacgg ccagtgccaa gcttaagacg tcgtcgtacg
     cgtggcgcct gcaggtcgac tctagaggat ccccgggtac cgcggccgca ttcaaggcct
     cgagggccca tatgcatgcg atcgatatcc atggagctcg cgaattcgta atcatggtca
     tagctgtttc ctgtgtgaaa ttgttatccg ctcacaattc cacacaacat acgagccgga
     agcataaagt gtaaagcctg gggtgcctaa tgagtgagct aactcacatt aattgcgttg
     cgctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc
     caacgcgcgg ggagaggcgg tttgcgtatt gggcgctctt ccgcttcctc gctcactgac
     tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata
     cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa
     aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct
     gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa
     agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg
     cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcaaagctca
     cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa
     ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg
     gtaagacacg acttatcgcc actggcagca gccactggta acaggattag cagagcgagg
     tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta cactagaaga
     acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc
     tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag
     attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac
     gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc
     ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag
     taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt
     ctatttcgtt catccatagt tgcctgactc cccgtcgtgt agataactac gatacgggag
     ggcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca
     gatttatcag caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact
     ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca
     gttaatagtt tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg
     tttggtatgg cttcattcag ctccggttcc caacgatcaa ggcgagttac atgatccccc
     atgttgtgca aaaaagcggt tagctccttc ggtcctccga tcgttgtcag aagtaagttg
     gccgcagtgt tatcactcat ggttatggca gcactgcata attctcttac tgtcatgcca
     tccgtaagat gcttttctgt gactggtgag tactcaacca agtcattctg agaatagtgt
     atgcggcgac cgagttgctc ttgcccggcg tcaatacggg ataataccgc gccacatagc
     agaactttaa aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc
     ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg cacccaactg atcttcagca
     tcttttactt tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa
     aagggaataa gggcgacacg gaaatgttga atactcatac tcttcctttt tcaatattat
     tgaagcattt atcagggtta ttgtctcatg agcggataca tatttgaatg tatttagaaa
     aataaacaaa taggggttcc gcgcacattt ccccgaaaag tgccacctga cgtctaagaa
     accattatta tcatgacatt aacctataaa aataggcgta tcacgaggcc ctttcgtc
//