back Return to this vector's summary.
ID   PUCDIS     preliminary; circular DNA; SYN; 2699 BP.
XX
AC   ATCC77302;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pUC-DIS - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pUR18 from pUC18 & pFL201.2
RC   pUR19 from pUC19 & pFL201.2
RC   pUR18N from pUR18
RC   pUR19N from pUR19
RC   pUC-DIS from pUC18
RC   pUD18 from ura4
RA   Barbet N., Muriel W.J., Carr A.M.;
RT   "Versatile shuttle vectors and genomic libraries for use with
RT   Schizosaccharomyces pombe";
RL   Gene 114:59-66(1992).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   Vector with a MCS containing only relatively rare enzyme cutting sites
CC   flanked by SfiI sites to facilitate removal of the insert. By reducing
CC   the number of sites in the plasmid, more sites in an insert can be
CC   used for gene disruption experiments.
CC   The order of the major features in this plasmid is:
CC   SfiI/SacI/MCS/SfiI/lacZ' - pMB1 ori - ampR.
CC   Restriction digests of the clone give the following sizes (kb):
CC   SphI--2.7; SacI--2.7; KpnI--2.7; SalI--2.7. (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pUC-DIS)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli DH5alpha)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pUC18)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC18 remove HindIII-EcoRI 51bp 400..451,
FT                   \ MCS/2635bp
FT                   2. oligo 60bp agctggccaa
FT                   \ gttgcccgagctcggtaccgatatcgtcgacgcatgcggccttgaaggcc
FT                   -> pUC-DIS 2695bp"
FT   -               1..403
FT                   /note="pUC18 1..403 403bp
FT                   HindIII = A^AGCT T
FT                   \                agctgg..."
FT   -               404..463
FT                   /note="60bp
FT                   \ agctggccaagttgcccgagctcggtaccgatatcgtcgacgcatgcggc
FT                   \ cttgaaggcc
FT                   \ ...aaggcc
FT                   EcoRI =   G^AATTC"
FT   -               464..2699
FT                   /note="pUC18 451..2686 2236bp"
FT   misc_binding    0..0
FT                   /note="MCS SfiI-SacI-SalI-EcoRV-KpnI-SphI-SfiI"
FT   misc_binding    0..0
FT                   /note="SIT unique SfiI-SacI-SalI-EcoRV-KpnI-SphI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   promoter        0..0
FT                   /note="PRO E. coli lac gene"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ');
FT                   reporter gene"
XX
SQ   Sequence 2699 BP; 671 A; 681 C; 687 G; 660 T; 0 other;
     tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
     accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc
     attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat
     tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt
     tttcccagtc acgacgttgt aaaacgacgg ccagtgccaa gctagctggc caagttgccc
     gagctcggta ccgatatcgt cgacgcatgc ggccttgaag gccaattcgt aatcatggtc
     atagctgttt cctgtgtgaa attgttatcc gctcacaatt ccacacaaca tacgagccgg
     aagcataaag tgtaaagcct ggggtgccta atgagtgagc taactcacat taattgcgtt
     gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc cagctgcatt aatgaatcgg
     ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct tccgcttcct cgctcactga
     ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa aggcggtaat
     acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa aaggccagca
     aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc
     tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata
     aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc
     gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcaaagctc
     acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga
     accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc
     ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag
     gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag
     aacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag
     ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca
     gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga
     cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat
     cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga
     gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg
     tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga
     gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc
     agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac
     tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc
     agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc
     gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta catgatcccc
     catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca gaagtaagtt
     ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta ctgtcatgcc
     atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg
     tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg cgccacatag
     cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac tctcaaggat
     cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc
     atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa
     aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatatta
     ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat gtatttagaa
     aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg acgtctaaga
     aaccattatt atcatgacat taacctataa aaataggcgt atcacgaggc cctttcgtc
//