back Return to this vector's summary.
ID   PUCPLAC1   preliminary; circular DNA; SYN; 8352 BP.
XX
AC   IG5090;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pUCPlac-1 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pUCPlac-1B from pMC1871 & pUChsneo
RC   pUCPlac-1, pUCPlac-11 from pUCPlac-1B & linker
RC   pUCPlac-2B from pUCPlac-1B
RC   pUCPlac-2, pUCPlac-12 from pUCPlac-2B & linker
RC   pUCPlac-3B from pUCPlac-2B
RC   pUCPlac-3, pUCPlac-13 from pUCPlac-3B & linker
RA   Molsberger G., Schafer U., Schafer M.;
RT   "A new set of lacZ fusion vectors, pUCPlac, for studying gene
RT   expression in Drosophila by P-mediated transformation";
RL   Gene 63:147-151(1988).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   MCS. oligonucleotide linker.
CC   NM (pUCPlac-1)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pUChsneo)(pMC1871)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pMC1871 BamHI-BamHI 3244bp 4246..7476..14,
FT                   \ lacZ
FT                   \ BamHI = 14 33 3105 4246
FT                   2. pUChsneo PvuII 5073bp 615..615, MCS
FT                   \ PvuII = 615 916 3534 3946
FT                   BamHI linker 8bp cggatccg:BamHI linker 8bp cggatccg
FT                   -> pUCPlac-1B 8317bp
FT                   1. pUCPlac-1B BamHI 8317bp, pMC1871 14
FT                   S1 nuclease
FT                   BamHI 8317bp, pMC1871 4246
FT                   mung bean nuclease
FT                   2. linker EcoRI-KpnI-SmaI-SalI-HindIII 27bp
FT                   \ gaattcggtacccgggtcgacaagctt
FT                   -> pUCPlac-1 8344bp"
FT   -               1..614
FT                   /note="pUChsneo 1..614 614bp
FT                   PvuII = CAG^CTG
FT                   \           cg"
FT   -               615..616
FT                   /note="cg 2bp
FT                   \ cg
FT                   \    gaattc..."
FT   -               617..643
FT                   /note="gaattcggtacccgggtcgacaagctt 27bp
FT                   \     ...agctt
FT                   BamHI = G^GATC C"
FT   -               644..3887
FT                   /note="pMC1871 4246..7476..13 3244bp
FT                   BamHI =   G^GATCC
FT                   \           gatccg"
FT   -               3888..3893
FT                   /note="gatccg 6bp
FT                   \    gatccg
FT                   PvuII = CAG^CTG"
FT   -               3894..8352
FT                   /note="pUChsneo 615..5073 4459bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 8352 BP; 2030 A; 2157 C; 2183 G; 1982 T; 0 other;
     catgatgaaa taacataagg tggtcccgtc gaaagccgaa gcttaccgaa gtatacactt
     aaattcagtg cacgtttgct tgttgagagg aaaggttgtg tgcggacgaa tttttttttg
     aaaacattaa cccttacgtg gaataaaaaa aaatgaaata ttgcaaattt tgctgcaaag
     ctgtgactgg agtaaaatta attcacgtgc cgaagtgtgc tattaagaga aaattgtggg
     agcagagcct tgggtgcagc cttggtgaaa actcccaaat ttgtgatacc cactttaatg
     attcgcagtg gaaggctgca cctgcaaaag gtcagacatt taaaaggagg cgactcaacg
     cagatgccgt acctagtaaa gtgatagagc ctgaaccaga aaagataaaa gaaggctata
     ccagtgggag tacacaaaca gagtaagttt gaatagtaaa aaaaatcatt tatgtaaaca
     ataacgtgac tgtgcgttag gtcctgttca ttgtttaatg aaaataagag cttgagggaa
     aacgccattc gccattcagg ctacgcaact gttgggaagg gcgatcggtg cgggcctctt
     cgctattacg ccagcggaat tcggtacccg ggtcgacaag cttgatcctc tacgccggac
     gcatcgtggc cggcatcacc ggcgccacag gtgcggttgc tggcgcctat atcgccgaca
     tcaccgatgg ggaagatcgg gctcgccact tcgggctcat gagcgcttgt ttcggcgtgg
     gtatggtggc aggccccgtg gccgggggac tgttgggcgc catctccttg catgcaccat
     tccttgcggc ggcggtgctc aacggcctca acctactact gggctgcttc ctaatgcagg
     agtcgcataa gggagagcgt cgaccgatgc ccttgagagc cttcaaccca gtcagctcct
     tccggtgggc gcggggcatg actatcgtcg ccgcacttat gactgtcttc tttatcatgc
     aactcgtagg acaggtgccg gcagcgctct gggtcatttt cggcgaggac cgctttcgct
     ggagcgcgac gatgatcggc ctgtcgcttg cggtattcgg aatcttgcac gccctcgctc
     aagccttcgt cactggtccc gccaccaaac gtttcggcga gaagcaggcc attatcgccg
     gcatggcggc cgacgcgctg ggctacgtct tgctggcgtt cgcgacgcga ggctggatgg
     ccttccccat tatgattctt ctcgcttccg gcggcatcgg gatgcccgcg ttgcaggcca
     tgctgtccag gcaggtagat gacgaccatc agggacagct tcaaggatcg ctcgcggctc
     ttaccagcct aacttcgatc actggaccgc tgatcgtcac ggcgatttat gccgcctcgg
     cgagcacatg gaacgggttg gcatggattg taggcgccgc cctatacctt gtctgcctcc
     ccgcgttgcg tcgcggtgca tggagccggg ccacctcgac ctgaatggaa gccggcggca
     cctcgctaac ggattcacca ctccaagaat tggagccaat caattcttgc ggagaactgt
     gaatgcgcaa accaaccctt ggcagaacat atccatcgcg tccgccatct ccagcagccg
     cacgcggcgc atctcgggca gcgttgggtc ctggccacgg gtgcgcatga tcgtgctcct
     gtcgttgagg acccggctag gctggcgggg ttgccttact ggttagcaga atgaatcacc
     gatacgcgag cgaacgtgaa gcgactgctg ctgcaaaacg tctgcgacct gagcaacaac
     atgaatggtc ttcggtttcc gtgtttcgta aagtctggaa acgcggaagt cagcgccctg
     caccattatg ttccggatct gcatcgcagg atgctgctgg ctaccctgtg gaacacctac
     atctgtatta acgaagcgct ggcattgacc ctgagtgatt tttctctggt cccgccgcat
     ccataccgcc agttgtttac cctcacaacg ttccagtaac cgggcatgtt catcatcagt
     aacccgtatc gtgagcatcc tctctcgttt catcggtatc attaccccca tgaacagaaa
     tcccccttac acggaggcat cagtgaccaa acaggaaaaa accgccctta acatggcccg
     ctttatcaga agccagacat taacgcttct ggagaaactc aacgagctgg acgcggatga
     acaggcagac atctgtgaat cgcttcacga ccacgctgat gagctttacc gcagctgcct
     cgcgcgtttc ggtgatgacg gtgaaaacct ctgacacatg cagctcccgg agacggtcac
     agcttgtctg taagcggatg ccgggagcag acaagcccgt cagggcgcgt cagcgggtgt
     tggcgggtgt cggggcgcag ccatgaccca gtcacgtagc gatagcggag tgtatactgg
     cttaactatg cggcatcaga gcagattgta ctgagagtgc accatatgcg gtgtgaaata
     ccgcacagat gcgtaaggag aaaataccgc atcaggcgct cttccgcttc ctcgctcact
     gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta
     atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag
     caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc
     cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta
     taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg
     ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcaatgc
     tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac
     gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac
     ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg
     aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga
     aggacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt
     agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag
     cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct
     gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg
     atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta aagtatatat
     gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc
     tgtctatttc gttcatccat agttgcctga ctccccgtcg tgtagataac tacgatacgg
     gagggcttac catctggccc cagtgctgca atgataccgc gagacccacg ctcaccggct
     ccagatttat cagcaataaa ccagccagcc ggaagggccg agcgcagaag tggtcctgca
     actttatccg cctccatcca gtctattaat tgttgccggg aagctagagt aagtagttcg
     ccagttaata gtttgcgcaa cgttgttgcc attgctgcag gtcgacggat ccgctggcga
     aggggggatg tgctgcaagg cgattaagtt gggtaacgcc agggttttcc cagtcagtac
     gttgtaaaac gacggccagt gccaagcttg gctgcaggtc gacggatccc cgggaattcg
     taatcatggt catagctgtt tcctgtgtga aattgttatc cgctcacaat tccacacaac
     atacgagccg gaagcataaa gtgtaaagcc tggggtgcct aatgagtgag gtaactcaca
     ttaattgcgt tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg ccagctggat
     taatgaatcg gccaacgcgc ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc
     tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca
     aaggcggtaa tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca
     aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg
     ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg
     acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt
     ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt
     tctcaatgct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc
     tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt
     gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt
     agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc
     tacactagaa ggacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa
     agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt
     tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct
     acggggtctg acgctcagtg gaacgaaaac tcacgttagg gattttggtc atgagattat
     caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa
     gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct
     cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta
     cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct
     caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg
     gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa
     gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt
     cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta
     catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca
     gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta
     ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct
     gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg
     cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac
     tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact
     gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa
     atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt
     ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat
     gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg
     acgtctaaga aaccattatt atcatgacat taacctataa aaataggcgt atcacgaggc
     cctttcgtct cgcgcgtttc ggtgatgacg gtgaaaacct ctgacacatg cagctcccgg
     agacggtcac agcttgtctg taagcggatg ccgggagcag acaagcccgt cagggcgcgt
     cagcgggtgt tggcgggtgt cggggctggc ttaactatgc ggcatcagag cagattgtac
     tgagagtgca ccatatgcgg tgtgaaatac cgcacagatg cgtaaggaga aaataccgca
     tcaggcgaat taattcccct agaatcccaa aacaaactgg ttattgtggt aggtcatttg
     tttggcagaa gaaaactcga gaaatttctc tggccgttat tcgttattct ctcttttctt
     tttgggtctc cctctctgca ctaatgctct ctcactctgt cacacagtaa acggcatact
     gctctcgttg gttcgagaga gcgcgcctcg aatgttcgcg aaaagagcgc cggagtataa
     atagagcgct tcgtctacgg agcgacaatt caattcaaac aagcaaagtg aacacgtcgc
     taagcgaaag ctaagcaaat aaacaagcgc agctgaacaa gctaaacaat ctgcagtaaa
     gtgcaagtta aagtgaatca attaaaagta accagcaacc aagtaaatca actgcaacta
     ctgaaatctg ccaagaagta attattgaat acaagaagag aactctgaat aggggatctg
     atcaagagac aggatgagga tcgtttcgca tgattgaaca agatggattg cacgcaggtt
     ctccggccgc ttgggtggag aggctattcg gctatgactg ggcacaacag acaatcggct
     gctctgatgc cgccgtgttc cggctgtcag cgcaggggcg cccggttctt tttgtcaaga
     ccgacctgtc cggtgccctg aatgaactgc aggacgaggc agcgcggcta tcgtggctgg
     ccacgacggg cgttccttgc gcagctgtgc tcgacgttgt cactgaagcg ggaagggact
     ggctgctatt gggcgaagtg ccggggcagg atctcctgtc atctcacctt gctcctgccg
     agaaagtatc catcatggct gatgcaatgc ggcggctgca tacgcttgat ccggctacct
     gcccattcga ccaccaagcg aaacatcgca tcgagcgagc acgtactcgg atggaagccg
     gtcttgtcga tcaggatgat ctggacgaag agcatcaggg gctcgcgcca gccgaactgt
     tcgccaggct caaggcgcgc atgcccgacg gcgaggatct cgtcgtgacc catggcgatg
     cctgcttgcc gaatatcatg gtggaaaatg gccgcttttc tggattcatc gactgtggcc
     ggctgggtgt ggcggaccgc tatcaggaca tagcgttggc tacccgtgat attgctgaag
     agcttggcgg cgaatgggct gaccgcttcc tcgtgcttta cggtatcgcc gctcccgatt
     cgcagcgcat cgccttctat cgccttcttg acgagttctt ctgagcggga ctctggggtt
     cgaaatgacc gaccaagcga cgcccaacct gccatcacga gatttcgatt ccaccgccgc
     cttctatgaa aggttgggct tcggaatcgt tttccgggac gccggctgga tgatcctcca
     gcgcggggat ctcatgctgg agttcttcgc ccaccccgat ccgtcgagcg tataaccatc
     tgtacaaaaa aggatttcct ttgcccagtc gtacgacttt gtacagatgg ttatcagatg
     tggacataaa aagaggatgt ttggatgtgg tcatagacct aatggacagt gatggagttg
     atgacgccga caagctttgc gtactcgctc aaattattaa aaataaaact ttaaaaataa
     tttcgtctaa ttaatattat gagttaattc aaaccccacg gacatgctaa gggttaatca
     acaatcatat cgctgtctca ctcagactca atacgacact cagaatacta ttcctttcac
     tcgcacttat tgcaagcata cgttaagtgg atgtctcttg ccgacgggac caccttatgt
     tatttcatca tg
//