back Return to this vector's summary.
ID   PVE1163    preliminary; circular DNA; SYN; 2719 BP.
XX
AC   M88476;
XX
DT   09-OCT-1992 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Streptomyces/E.coli plasmid vector pVE1163 - complete, MCS.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-88
RC   pVE1163 from pUC18 & linker MCS1
RC   M13strep from M13mp1 & linker MCS1
RC   pVE2036 from linker MCS2 & pVE616
RC   pVE1043 from linker MCS3 & pIJ922
RA   Gewain K.M., Occi J.L., Foor F., MacNeil D.J.;
RT   "Vectors for generating nested deletions and facilitating subcloning
RT   G+C-rich DNA between Escherichia coli and Streptomyces sp";
RL   Gene 119:149-150(1992).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   M13strep has 7300 bp.
CC   NCBI gi: 208817
CC   NM (pVE1163)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pUC18)
CC   BR (M13strep)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC18 remove HindIII-EcoRI 51bp 400..451,
FT                   \ MCS/2635bp
FT                   blunt end:blunt end
FT                   2. linker MCS1 88bp
FT                   \ aattgctttaaattaatgatcagatctaagcttcccgggtacctcgagct
FT                   \ ctgcaggctagcatgcggatccgaattcgttaactcga
FT                   -> pVE1163 2723bp"
FT   -               1..399
FT                   /note="pUC18 1..399 399bp
FT                   HindIII = A^AGCTT
FT                   \           aattgc..."
FT   -               400..487
FT                   /note="88bp
FT                   \ aattgctttaaattaatgatcagatctaagcttcccgggtacctcgagct
FT                   \ ctgcaggctagcatgcggatccgaattcgttaactcga
FT                   \    ...actcga
FT                   EcoRI = G^AATT C"
FT   -               488..2719
FT                   /note="pUC18 455..2686 2232bp"
FT   misc_feature    0..0
FT                   /note="MCS DraI-AseI-BclI-BglII-HindIII-SmaI-KpnI-
FT                   XhoI-SstI-PstI-NheI-SphI-BamHI-EcoRI-HpaI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 2719 BP; 680 A; 682 C; 686 G; 671 T; 0 other;
     tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
     accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc
     attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat
     tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt
     tttcccagtc acgacgttgt aaaacgacgg ccagtgccaa attgctttaa attaatgatc
     agatctaagc ttcccgggta cctcgagctc tgcaggctag catgcggatc cgaattcgtt
     aactcgacgt aatcatggtc atagctgttt cctgtgtgaa attgttatcc gctcacaatt
     ccacacaaca tacgagccgg aagcataaag tgtaaagcct ggggtgccta atgagtgagc
     taactcacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc
     cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct
     tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca
     gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac
     atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt
     ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg
     cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc
     tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc
     gtggcgcttt ctcaaagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc
     aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac
     tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt
     aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct
     aactacggct acactagaag aacagtattt ggtatctgcg ctctgctgaa gccagttacc
     ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt
     ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg
     atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc
     atgagattat caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa
     tcaatctaaa gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag
     gcacctatct cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg
     tagataacta cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga
     gacccacgct caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag
     cgcagaagtg gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa
     gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctacaggc
     atcgtggtgt cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca
     aggcgagtta catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg
     atcgttgtca gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat
     aattctctta ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc
     aagtcattct gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaatacgg
     gataataccg cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg
     gggcgaaaac tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt
     gcacccaact gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca
     ggaaggcaaa atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata
     ctcttccttt ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac
     atatttgaat gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa
     gtgccacctg acgtctaaga aaccattatt atcatgacat taacctataa aaataggcgt
     atcacgaggc cctttcgtc
//