back Return to this vector's summary.
ID   PWB305     preliminary; circular DNA; SYN; 8018 BP.
XX
AC   M86847;
XX
DT   03-MAR-1992 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pWB305 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-8018
RC   pWB305 from pBR322 & synthetic lacUV5 & kan & lacZ & supF
RA   Barnes W.M.;
RT   "The fidelity of Taq polymerase catalyzing PCR is improved by an
RT   N-terminal deletion";
RL   Gene 112:29-35(1992).
XX
CC   NM (pWB305)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)(PCR fidelity)
CC   SE ()
CC   PA (pBR322)(pWB146)(E.coli supF)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 PvuII-EcoRI 2294bp 2067..4361,
FT                   \ ori/amp gene
FT                   2. E. coli 203bp 1106..1308, synthetic lacUV5 promoter
FT                   \ caggaaacagctatggatccgattacggattcactggccgtcgttttaca
FT                   \ acgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcag
FT                   \ cacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgat
FT                   \ cgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctg
FT                   \ gtt
FT                   3. pBR322 EcoRI-HindIII 31bp 4360..4361..30
FT                   4. pWB146 66bp 1632..1698
FT                   5. Tn5 BglII-BamHI 1541bp 1516..3057, neo/kan gene
FT                   6. E. coli 3075bp, lacZ gene/lacY gene [1287..1291]
FT                   \ #J01636
FT                   7. E. coli 219bp, supF gene tRNA-tyr [in lacY gene]
FT                   \ #M25496 23..243
FT                   -> pWB305 8018bp"
FT   promoter        3..205
FT                   /note="PRO E. coli lacUV5 gene, from bases 1106..1308
FT                   (#J01636)"
FT   misc_feature    208..240
FT                   /note="from pBR322, bases 1..33 (#V01119)"
FT   misc_feature    242..308
FT                   /note="from pWB146, bases 1632..1698 (#M61152)"
FT   CDS             315..1094
FT                   /note="ANT E. coli neomycin phosphotransferase II gene
FT                   (NPTII), neomycin resistance gene (neo)
FT                   kanamycin resistance gene (kan)
FT                   from transposon Tn5, bases 166..945 (#J01834)"
FT   misc_binding    860..860
FT                   /note="SIT StyI"
FT   CDS             1106..5720
FT                   /note="GEN E. coli beta-galactosidase gene (lacZY-)
FT                   (#J01636)"
FT   misc_binding    1121..1125
FT                   /note="SIT BamHI of lacZY bases 1287..1291 (#J01636)"
FT   misc_feature    4824..4824
FT                   /note="E. coli supF gene insertion"
FT   CDS             4658..4878
FT                   /note="GEN E. coli supF gene,
FT                   bases 23..243 (#M25496)"
FT   misc_binding    5720..5720
FT                   /note="SIT HindIII"
FT   misc_feature    5723..8018
FT                   /note="from pBR322, bases 2068..4363 (#V01119)"
XX
SQ   Sequence 8018 BP; 1800 A; 2085 C; 2138 G; 1995 T; 0 other;
     ttccgattca ttaatgcagc tggcacgaca ggtttcccga ctggaaagcg ggcagtgagc
     gcaacgcaat taatgtgagt tagctcactc attaggcacc ccaggcttta cactttatgc
     ttccggctcg tataatgtgt ggaattgtga gcggataaca atttcacaca ggaaacagct
     atgaccatga ttacggattc actggaattc tcatgtttga cagcttatca tcgataagct
     cagatctctc tcaatccaaa taatctgcaa tggcaattac cggatcttgg aggttactta
     tggatccctc gaggggattg cacgcaggtt ctccggccgc ttgggtggag aggctattcg
     gctatgactg ggcacaacag acaatcggct gctctgatgc cgccgtgttc cggctgtcag
     cgcaggggcg cccggttctt tttgtcaaga ccgacctgtc cggtgccctg aatgaactgc
     aggacgaggc agcgcggcta tcgtggctgg ccacgacggg cgttccttgc gcagctgtgc
     tcgacgttgt cactgaagcg ggaagggact ggctgctatt gggcgaagtg ccggggcagg
     atctcctgtc atctcacctt gctcctgccg agaaagtatc catcatggct gatgcaatgc
     ggcggctgca tacgcttgat ccggctacct gcccattcga ccaccaagcg aaacatcgca
     tcgagcgagc acgtactcgg atggaagccg gtcttgtcga tcaggatgat ctggacgaag
     agcatcaggg gctcgcgcca gccgaactgt tcgccaggct caaggcgcgc atgcccgacg
     gcgaggatct cgtcgtgacc catggcgatg cctgcttgcc gaatatcatg gtggaaaatg
     gccgcttttc tggattcatc gactgtggcc ggctgggtgt ggcggaccgc tatcaggaca
     tagcgttggc tacccgtgat attgctgaag agcttggcgg cgaatgggct gaccgcttcc
     tcgtgcttta cggtatcgcc gctcccgatt cgcagcgcat cgccttctat cgccttcttg
     acgagttctt ctgaagctca gatctcagga aacagctatg gatccgatta cggattcact
     ggccgtcgtt ttacaacgtc gtgactggga aaaccctggc gttacccaac ttaatcgcct
     tgcagcacat ccccctttcg ccagctggcg taatagcgaa gaggcccgca ccgatcgccc
     ttcccaacag ttgcgcagcc tgaatggcga atggcgcttt gcctggtttc cggcaccaga
     agcggtgccg gaaagctggc tggagtgcga tcttcctgag gccgatactg tcgtcgtccc
     ctcaaactgg cagatgcacg gttacgatgc gcccatctac accaacgtaa cctatcccat
     tacggtcaat ccgccgtttg ttcccacgga gaatccgacg ggttgttact cgctcacatt
     taatgttgat gaaagctggc tacaggaagg ccagacgcga attatttttg atggcgttaa
     ctcggcgttt catctgtggt gcaacgggcg ctgggtcggt tacggccagg acagtcgttt
     gccgtctgaa tttgacctga gcgcattttt acgcgccgga gaaaaccgcc tcgcggtgat
     ggtgctgcgt tggagtgacg gcagttatct ggaagatcag gatatgtggc ggatgagcgg
     cattttccgt gacgtctcgt tgctgcataa accgactaca caaatcagcg atttccatgt
     tgccactcgc tttaatgatg atttcagccg cgctgtactg gaggctgaag ttcagatgtg
     cggcgagttg cgtgactacc tacgggtaac agtttcttta tggcagggtg aaacgcaggt
     cgccagcggc accgcgcctt tcggcggtga aattatcgat gagcgtggtg gttatgccga
     tcgcgtcaca ctacgtctga acgtcgaaaa cccgaaactg tggagcgccg aaatcccgaa
     tctctatcgt gcggtggttg aactgcacac cgccgacggc acgctgattg aagcagaagc
     ctgcgatgtc ggtttccgcg aggtgcggat tgaaaatggt ctgctgctgc tgaacggcaa
     gccgttgctg attcgaggcg ttaaccgtca cgagcatcat cctctgcatg gtcaggtcat
     ggatgagcag acgatggtgc aggatatcct gctgatgaag cagaacaact ttaacgccgt
     gcgctgttcg cattatccga accatccgct gtggtacacg ctgtgcgacc gctacggcct
     gtatgtggtg gatgaagcca atattgaaac ccacggcatg gtgccaatga atcgtctgac
     cgatgatccg cgctggctac cggcgatgag cgaacgcgta acgcgaatgg tgcagcgcga
     tcgtaatcac ccgagtgtga tcatctggtc gctggggaat gaatcaggcc acggcgctaa
     tcacgacgcg ctgtatcgct ggatcaaatc tgtcgatcct tcccgcccgg tgcagtatga
     aggcggcgga gccgacacca cggccaccga tattatttgc ccgatgtacg cgcgcgtgga
     tgaagaccag cccttcccgg ctgtgccgaa atggtccatc aaaaaatggc tttcgctacc
     tggagagacg cgcccgctga tcctttgcga atacgcccac gcgatgggta acagtcttgg
     cggtttcgct aaatactggc aggcgtttcg tcagtatccc cgtttacagg gcggcttcgt
     ctgggactgg gtggatcagt cgctgattaa atatgatgaa aacggcaacc cgtggtcggc
     ttacggcggt gattttggcg atacgccgaa cgatcgccag ttctgtatga acggtctggt
     ctttgccgac cgcacgccgc atccagcgct gacggaagca aaacaccagc agcagttttt
     ccagttccgt ttatccgggc aaaccatcga agtgaccagc gaatacctgt tccgtcatag
     cgataacgag ctcctgcact ggatggtggc gctggatggt aagccgctgg caagcggtga
     agtgcctctg gatgtcgctc cacaaggtaa acagttgatt gaactgcctg aactaccgca
     gccggagagc gccgggcaac tctggctcac agtacgcgta gtgcaaccga acgcgaccgc
     atggtcagaa gccgggcaca tcagcgcctg gcagcagtgg cgtctggcgg aaaacctcag
     tgtgacgctc cccgccgcgt cccacgccat cccgcatctg accaccagcg aaatggattt
     ttgcatcgag ctgggtaata agcgttggca atttaaccgc cagtcaggct ttctttcaca
     gatgtggatt ggcgataaaa aacaactgct gacgccgctg cgcgatcagt tcacccgtgc
     accgctggat aacgacattg gcgtaagtga agcgacccgc attgacccta acgcctgggt
     cgaacgctgg aaggcggcgg gccattacca ggccgaagca gcgttgttgc agtgcacggc
     agatacactt gctgatgcgg tgctgattac gaccgctcac gcgtggcagc atcaggggaa
     aaccttattt atcagccgga aaacctaccg gattgatggt agtggtcaaa tggcgattac
     cgttgatgtt gaagtggcga gcgatacacc gcatccggcg cggattggcc tgaactgcca
     gctggcgcag gtagcagagc gggtaaactg gctcggatta gggccgcaag aaaactatcc
     cgaccgcctt actgccgcct gttttgaccg ctgggatctg ccattgtcag acatgtatac
     cccgtacgtc ttcccgagcg aaaacggtct gcgctgcggg acgcgcgaat tgaattatgg
     cccacaccag tggcgcggcg acttccagtt caacatcagc cgctacagtc aacagcaact
     gatggaaacc agccatcgcc atctgctgca cgcggaagaa ggcacatggc tgaatatcga
     cggtttccat atggggattg gtggcgacga ctcctggagc ccgtcagtat cggcggaatt
     ccagctgagc gccggtcgct accattacca gttggtctgg tgtcaaaaat aataataacc
     gggcaggcca tgtctgcccg tatttcgcgt aaggaaatcc attatgtact atttaaaaaa
     cacaaacttt tggatgttcg gtttattctt tttcttttac ttttttatca tgggagccta
     cttcccgttt ttcccgattt ggctacatga catcaaccat atcagcaaaa gtgatacggg
     tattattttt gccgctattt ctctgttctc gctattattc caaccgctgt ttggtctgct
     ttctgacaaa ctcgggctgc gcaaatacct gctgtggatt attaccggca tgttagtgat
     gtttgcgccg ttctttattt ttatcttcgg gccactgtta caatacaaca ttttagtagg
     atcgattgtt ggtggtattt atctaggctt ttgttttaac gccggtgcgc cagcagtaga
     ggcatttatt gagaaagtca gccgtcgcag taatttcgga tcctaattct ttctcaacgt
     aacactttac agcggcgcgt catttgatat gatgcgcccc gcttcccgat aagggagcag
     gccagtaaaa gcattacccg tggtggggtt cccgagcggc caaagggagc agactctaaa
     tctgccgtca tcgacttcga aggttcgaat ccttccccca ccaccatcac tttcaaaagt
     ccgaaagaat taggatccga atttggtcgc gcgcggatgt ttggctgtgt tggctgggcg
     ctgtgtgcct cgattgtcgg catcatgttc accatcaata atcagtttgt tttctggctg
     ggctctggct gtgcactcat cctcgccgtt ttactctttt tcgccaaaac ggatgcgccc
     tcttctgcca cggttgccaa tgcggtaggt gccaaccatt cggcatttag ccttaagctg
     gcactggaac tgttcagaca gccaaaactg tggtttttgt cactgtatgt tattggcgtt
     tcctgcacct acgatgtttt tgaccaacag tttgctaatt tctttacttc gttctttgct
     accggtgaac agggtacgcg ggtatttggc tacgtaacga caatgggcga attacttaac
     gcctcgatta tgttctttgc gccactgatc attaatcgca tcggtgggaa aaacgccctg
     ctgctggctg gcactattat gtctgtacgt attattggct catcgttcgc cacctcagcg
     ctggaagtgg ttattctgaa aacgctgcat atgtttgaag taccgttcct gctggtgggc
     tgctttaaat atattaccag ccagtttgaa gtgcgttttt cagcgacgat ttatctggtc
     tgtttctgct tctttaagca actggcgatg atttttatgt ctgtactggc gggcaatatg
     tatgaaagca tcggtttcca gggcgcttat ctggtgctgg gtctggtggc gctgggcttc
     accttaattt ccgtgttcac gcttagcggc cccggcccgc tttccctgct gcgtcgtcag
     gtgaatgaag tcgcttaagc ttgctgcctc gcgcgtttcg gtgatgacgg tgaaaacctc
     tgacacatgc agctcccgga gacggtcaca gcttgtctgt aagcggatgc cgggagcaga
     caagcccgtc agggcgcgtc agcgggtgtt ggcgggtgtc ggggcgcagc catgacccag
     tcacgtagcg atagcggagt gtatactggc ttaactatgc ggcatcagag cagattgtac
     tgagagtgca ccatatgcgg tgtgaaatac cgcacagatg cgtaaggaga aaataccgca
     tcaggcgctc ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc
     gagcggtatc agctcactca aaggcggtaa tacggttatc cacagaatca ggggataacg
     caggaaagaa catgtgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt
     tgctggcgtt tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa
     gtcagaggtg gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct
     ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc
     cttcgggaag cgtggcgctt tctcaatgct cacgctgtag gtatctcagt tcggtgtagg
     tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct
     tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag
     cagccactgg taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga
     agtggtggcc taactacggc tacactagaa ggacagtatt tggtatctgc gctctgctga
     agccagttac cttcggaaaa agagttggta gctcttgatc cggcaaacaa accaccgctg
     gtagcggtgg tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag
     aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaaac tcacgttaag
     ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta aattaaaaat
     gaagttttaa atcaatctaa agtatatatg agtaaacttg gtctgacagt taccaatgct
     taatcagtga ggcacctatc tcagcgatct gtctatttcg ttcatccata gttgcctgac
     tccccgtcgt gtagataact acgatacggg agggcttacc atctggcccc agtgctgcaa
     tgataccgcg agacccacgc tcaccggctc cagatttatc agcaataaac cagccagccg
     gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag tctattaatt
     gttgccggga agctagagta agtagttcgc cagttaatag tttgcgcaac gttgttgcca
     ttgctgcagg catcgtggtg tcacgctcgt cgtttggtat ggcttcattc agctccggtt
     cccaacgatc aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg gttagctcct
     tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt gttatcactc atggttatgg
     cagcactgca taattctctt actgtcatgc catccgtaag atgcttttct gtgactggtg
     agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc tcttgcccgg
     cgtcaacacg ggataatacc gcgccacata gcagaacttt aaaagtgctc atcattggaa
     aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc agttcgatgt
     aacccactcg tgcacccaac tgatcttcag catcttttac tttcaccagc gtttctgggt
     gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt
     gaatactcat actcttcctt tttcaatatt attgaagcat ttatcagggt tattgtctca
     tgagcggata catatttgaa tgtatttaga aaaataaaca aataggggtt ccgcgcacat
     ttccccgaaa agtgccacct gacgtctaag aaaccattat tatcatgaca ttaacctata
     aaaataggcg tatcacgagg ccctttcgtc ttcaagaa
//