back Return to this vector's summary.
ID   PXPRSP     preliminary; circular DNA; SYN; 3753 BP.
AC   IG1139; ATCC67726;
DT   01-FEB-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
DE   Vertebrate/E.coli phagemid vector pXPRS+ or pcDpolyB+ - complete.
KW   cloning vector.
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
RN   [1]
RC   pcDpoly from pL1 & pcDV1 & BlueScribe M13+
RC   pcDpolyB from pcDpoly & oligo
RC   pXPRS+ or pCDpolyB+ from pcDpolyB & BlueScribe M13+
RC   pXPRS- or pCDpolyB- from pcDpolyB & BlueScribe M13+
RC   BSB+ from BlueScribe M13+ & oligo
RC   BSB- from BlueScribe M13- & oligo
RA   Pruitt S.C.;
RT   "Expression vectors permitting cDNA cloning and enrichment for
RT   specific sequences by hybridization/selection";
RL   Gene 66:121-134(1988).
CC   + makes non-coding strand of gene. - makes coding strand of gene.
CC   pcDpolyB+ and pcDpolyB- differ in their orientations of the intergenic
CC   region from bacteriophage f1. Libraries constructed with each vector
CC   for a different cell type can be screened against each other for
CC   cell-specific sequences.
CC   A vector which maintains the cDNA cloning features of the Okayama-Berg
CC   vector while increasing the efficiency of making
CC   transformation-competent, cDNA-containing plasmids and allows
CC   enrichment by hybridization/selection.
CC   Allows expression of cloned cDNAs in eukaryotic cells from the SV40
CC   early region promoter.
CC   Contains the intergenic region from bacteriophage f1 permitting
CC   synthesis of single-strand copies of the insert.
CC   Restriction digests of the clone give the following sizes (kb):
CC   KpnI--3.7; KpnI/HindIII--3.2, 0.5; BamHI--3.7; PvuII--uncut;
CC   PstI--3.7. (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pXPRS+)(pcDpolyB+)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (phagemid)
CC   HO (E.coli HB101)(vertebrate cells)(E.coli)
CC   CP ()
CC   FN (cloning)(expression)
CC   SE ()
CC   PA (pBR322)(f1)
CC   BR (pXPRS-)
CC   OF ()
CC   OR ()
FH   Key             Location/Qualifiers
FT   misc_feature    0..0
FT                   /note="1. pcDV1 KpnI-HindIII ?..2536, SV40 polyA
FT                   \ pcDX HindIII 2536
FT                   \ SV40 KpnI 299
FT                   2. pL1 HindIII-PstI, SV40 early/splice
FT                   3. BlueScribe M13+ PstI-KpnI 27bp 898..925, MCS
FT                   -> pcDpoly 3800bp
FT                   1. pcDpoly remove PstI-XbaI 16bp, MCS
FT                   \ BlueScribe M13+ 909..925/3800bp
FT                   2. oligo PstI-BstXI-XbaI 14bp ccaggggggtggct
FT                   \ 3'acgtggtccccccaccgagatc5'
FT                   -> pcDpolyB' 3800bp
FT                   1. pcDpolyB' SmaI 3800bp, SV40
FT                   XbaI linker 6bp tctaga
FT                   -> pcDpolyB 3800bp
FT                   1. pcDpolyB remove small ClaI-SalI, MCS
FT                   \ pBR322 25..652/3170bp
FT                   2. BlueScribe M13+ NdeI-PvuII 582bp 185..767, ori
FT                   ClaI-SalI linker 12bp atcgatgtcgac:ClaI-SalI linker
FT                   \ 12bp atcgatgtcgac
FT                   ClaI-SalI 580bp, ori
FT                   -> pXPRS+ 3753bp"
FT   rep_origin      complement(0..0)
FT                   /note="ORI bacteriophage f1"
FT   misc_binding    2..2
FT                   /note="SIT unique SalI"
FT   misc_binding    188..188
FT                   /note="SIT unique NaeI"
FT   misc_binding    218..218
FT                   /note="SIT unique BanII"
FT   misc_binding    291..291
FT                   /note="SIT unique DraIII"
FT   rep_origin      0..0
FT                   /note="ORI SV40"
FT   promoter        0..0
FT                   /note="PRO SV40 early genes"
FT   misc_binding    592..592
FT                   /note="SIT unique BanIII"
FT   misc_binding    598..598
FT                   /note="SIT unique HindIII"
FT   misc_binding    836..836
FT                   /note="SIT unique NcoI"
FT   misc_binding    875..875
FT                   /note="SIT unique SfiI"
FT   misc_feature    0..0
FT                   /note="SPL SV40 splicing sequences"
FT   misc_binding    1012..1012
FT                   /note="SIT unique PpuMI"
FT   misc_binding    1121..1161
FT                   /note="MCS unique BstXI-XbaI-KpnI"
FT   misc_binding    1121..1121
FT                   /note="SIT unique BstXI"
FT   misc_binding    1153..1153
FT                   /note="SIT unique XbaI"
FT   misc_binding    1161..1161
FT                   /note="SIT unique KpnI"
FT   polyA_signal    0..0
FT                   /note="PLA SV40 early genes"
FT   misc_binding    1434..1434
FT                   /note="SIT unique BsaBI"
FT   misc_binding    1596..1596
FT                   /note="SIT unique SmaI"
FT   misc_binding    1601..1601
FT                   /note="SIT unique NotI"
FT   misc_binding    1602..1602
FT                   /note="SIT unique Eco52I"
FT   misc_binding    1685..1685
FT                   /note="SIT unique NdeI"
FT   misc_binding    1838..1838
FT                   /note="SIT unique TfiI"
FT   misc_binding    1863..1863
FT                   /note="SIT unique AflIII"
FT   rep_origin      complement(0..0)
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   misc_binding    2274..2274
FT                   /note="SIT unique AlwNI"
FT   CDS             complement(0..0)
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   misc_binding    2823..2823
FT                   /note="SIT unique BsaI"
FT   misc_binding    2927..2927
FT                   /note="SIT unique AseI"
FT   misc_binding    2976..2976
FT                   /note="SIT unique FspI"
FT   misc_binding    2997..2997
FT                   /note="SIT unique PstI"
FT   misc_binding    3234..3234
FT                   /note="SIT unique ScaI"
FT   misc_binding    3272..3272
FT                   /note="SIT unique BcgI"
FT   misc_binding    3674..3674
FT                   /note="SIT unique AatII"
FT   misc_binding    3741..3741
FT                   /note="SIT unique BbsI"
SQ   Sequence 3753 BP; 933 A; 940 C; 922 G; 958 T; 0 other;
     ggtcgaccta tgcggtgtga aataccgcac agatgcgtaa ggagaaaata ccgcatcagg
     cgacgcgccc tgtagcggcg cattaagcgc ggcgggtgtg gtggttacgc gcagcgtgac
     cgctacactt gccagcgccc tagcgcccgc tcctttcgct ttcttccctt cctttctcgc
     cacgttcgcc ggctttcccc gtcaagctct aaatcggggg ctccctttag ggttccgatt
     tagtgcttta cggcacctcg accccaaaaa acttgattag ggtgatggtt cacgtagtgg
     gccatcgccc tgatagacgg tttttcgccc tttgacgttg gagtccacgt tctttaatag
     tggactcttg ttccaaactg gaacaacact caaccctatc tcggtctatt cttttgattt
     ataagggatt ttgccgattt cggcctattg gttaaaaaat gagctgattt aacaaaaatt
     taacgcgaat tttaacaaaa tattaacgtt tacaatttcg ccattcgcca ttcaggctac
     gcaactgttg ggaagggcga tcggtgcggg cctcttcgct attacgccag catcgataag
     cttggctgtg gaatgtgtgt cagttagggt gtggaaagtc cccaggctcc ccagcaggca
     gaagtatgca aagcatgcat ctcaattagt cagcaaccag gtgtggaaag tccccaggct
     ccccagcagg cagaagtatg caaagcatgc atctcaatta gtcagcaacc atagtcccgc
     ccctaactcc gcccatcccg cccctaactc cgcccagttc cgcccattct ccgccccatg
     gctgactaat tttttttatt tatgcagagg ccgaggccgc ctcggcctct gagctattcc
     agaagtagtg aggaggcttt tttggaggcc taggcttttg caaaaagctc ctcgaggaac
     tgaaaaacca gaaagttaac tggtaagttt agtctttttg tcttttattt caggtcccgg
     atccggtggt ggtgcaaatc aaagaactgc tcctcagtgg atgttgcctt tacttctagg
     cctgtacgga agtgttactt ctgctctaaa agctgctgca ccaggggggt ggctctagct
     agaggatccc cctctagagg ggtaccttct gaggcggaaa gaaccagccg gatccctcga
     gggatccaga catgataaga tacattgatg agtttggaca aaccacaact agaatgcagt
     gaaaaaaatg ctttatttgt gaaatttgtg atgctattgc tttatttgta accattataa
     gctgcaataa acaagttaac aacaacaatt gcattcattt tatgtttcag gttcaggggg
     aggtgtggga ggttttttaa agcaagtaaa acctctacaa atgtggtatg gctgattatg
     atcctgcctc gcgcgtttcg gtgatgacgg tgaaaacctc tgacacatgc agctcccgga
     gacggtcaca gcttgtctgt aagcggatgc cgggagcaga caagcccgtc agggcgcgtc
     agcgggtgtt ggcgggtgtc ggggcgcagc catgacccgg gcggccgccc cagtcacgta
     gcgatagcgg agtgtatact ggcttaacta tgcggcatca gagcagattg tactgagagt
     gcaccatatg cggtgtgaaa taccgcacag atgcgtaagg agaaaatacc gcatcaggcg
     ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt
     atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa
     gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc
     gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag
     gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt
     gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg
     aagcgtggcg ctttctcata gctcacgctg taggtatctc agttcggtgt aggtcgttcg
     ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg
     taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac
     tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg
     gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc tgaagccagt
     taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg
     tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc aagaagatcc
     tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt aagggatttt
     ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa aatgaagttt
     taaatcaatc taaagtatat atgagtaaac ttggtctgac agttaccaat gcttaatcag
     tgaggcacct atctcagcga tctgtctatt tcgttcatcc atagttgcct gactccccgt
     cgtgtagata actacgatac gggagggctt accatctggc cccagtgctg caatgatacc
     gcgagaccca cgctcaccgg ctccagattt atcagcaata aaccagccag ccggaagggc
     cgagcgcaga agtggtcctg caactttatc cgcctccatc cagtctatta attgttgccg
     ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg ccattgctgc
     aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg gttcccaacg
     atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc
     tccgatcgtt gtcagaagta agttggccgc agtgttatca ctcatggtta tggcagcact
     gcataattct cttactgtca tgccatccgt aagatgcttt tctgtgactg gtgagtactc
     aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaac
     acgggataat accgcgccac atagcagaac tttaaaagtg ctcatcattg gaaaacgttc
     ttcggggcga aaactctcaa ggatcttacc gctgttgaga tccagttcga tgtaacccac
     tcgtgcaccc aactgatctt cagcatcttt tactttcacc agcgtttctg ggtgagcaaa
     aacaggaagg caaaatgccg caaaaaaggg aataagggcg acacggaaat gttgaatact
     catactcttc ctttttcaat attattgaag catttatcag ggttattgtc tcatgagcgg
     atacatattt gaatgtattt agaaaaataa acaaataggg gttccgcgca catttccccg
     aaaagtgcca cctgacgtct aagaaaccat tattatcatg acattaacct ataaaaatag
     gcgtatcacg aggccctttc gtcttcaaga att