back Return to this vector's summary.
ID   PYAC2      preliminary; circular DNA; SYN; 11463 BP.
XX
AC   U01086; J01381; ATCC67380;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli YAC vector pYAC2 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   plasmid from YIp5
RC   pPM662 from plasmid & YCp19
RC   pPM664 from pPM662 & linker & pSU4-A, sup4-o gene
RC   pPM668 from pPM664
RC   pYAC2 from pPM668 & linker & A240p1
RC   pYAC3 from pYAC2
RC   pYAC4 from pYAC3 & linker
RC   pYAC5, pYAC55 from pYAC3 & linker
RA   Burke D.T., Carle G.F., Olson M.V.;
RT   "Cloning of large segments of exogenous DNA into yeast by means of
RT   artificial chromosome vectors";
RL   Science 236:806-812(1987).
XX
RN   [2]
RC   M13mp5::pSU4-A from M13mp5 & pSU4-A
RC   pC66 from M13mp5::pSU4-A & pTC3 & linker
RC   pC689 from M13mp5::pSU4-A & pTC3 & linker
RC   pC723 from M13mp5::pSU4-A & pTC3 & linker
RC   pC865 from M13mp5::pSU4-A & pTC3 & linker
RC   pC68 from M13mp5::pSU4-A & pTC3 & linker
RC   pC888-1, pC888-2 from M13mp5::pSU4-A & pTC3 & linker
RA   Shaw K.J., Olson M.V.;
RT   "Effects of altered 5'-flanking sequences on the in vivo
RT   expression of a Saccharomyces cerevisiae tRNATyr gene";
RL   Mol. Cell. Biol. 4:657-665(1984).
XX
RN   [3]
RC   A240p1 from lambda & telomere & HIS3 gene
RA   Murray A.W.;
RT   ;
RL   Unpublished (1987).
XX
RN   [4]
RC   pD4, pD5 from ARS1/TRP1 gene & CEN4 or pNN130 & URA3 gene & lambda
RC   pD14 from CYH gene & URA3 gene & LEU2 gene mutant
RC   A252p6 from lambda & LEU2 gene & HIS3 gene
RC   pSZ536 from ARS & LEU2 & HIS3 gene mutant
RC   yeastplasmid from YLp21 & A252p6
RC   yeastplasmid2 from yeastplasmid & pD5
RC   yeastYLp45 from yeastplasmid2 & pSZ536
RC   yeastplasmid3 from yeastplasmid & pD4
RC   YLp48 from yeastplasmid3 & pD14
RC   YLp53 from YLp48
RC   YLp54 from YLp22 & pD32
RA   Dawson D.S., Murray A.W., Szostak J.W.;
RT   "An alternative pathway for meiotic chromosome segregation in
RT   yeast";
RL   Science 234:713-717(1986).
XX
RN   [5]
RC   A90p2 from lambda
RC   A164p2 from lambda
RC   A233p1 from lambda
RC   YLp16 from A90p2 & pSZ221, Tetrahymena telomere
RC   A164p2 from A90p2
RC   from A164p2
RC   from A233p1 & chromosome III-TcA
RA   Murray A.W., Szostak J.W.;
RT   "Construction and behavior of circularly permuted and telocentric
RT   chromosomes in Saccharomyces cerevisiae";
RL   Mol. Cell. Biol. 6:3166-3172(1986).
XX
RN   [6]
RC   pSU4-A from yeast sup4-o gene
RA   Goodman H.M., Olson M.V., Hall B.D.;
RT   "Nucleotide sequence of a mutant eukaryotic gene: the yeast
RT   tyrosine-inserting ochre suppressor SUP4-o";
RL   Proc. Natl. Acad. Sci. U.S.A. 74:5453-5457(1977).
XX
RN   [7]
RC   M13mp5::SUP4-o from M13mp5 & pSU4-A
RA   Sandmeyer S.B.;
RT   ;
RL   Unpublished (1984).
XX
RN   [8]
RC   pTC3 from YRp7 & pYe(CEN3)11
RA   Nasmyth K.;
RT   ;
RL   Unpublished (1984).
XX
RN   [9]
RC   pD32 from CEN4 or pNN130 & ARS2 & LYS2 gene
RA   Rothstein R.J.;
RT   "One-step gene disruption in yeast";
RL   Meth. Enzymol. 101:202-211(1983).
XX
RN   [10]
RC   YLp21 from YLp17 & lambda
RC   YLp22 from YLp21 & URA3 gene
RA   Murray A.W., Szostak J.W.;
RT   "Construction of artificial chromosomes in yeast";
RL   Nature 305:189-193(1983).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   This yeast artificial chromosome contains ARS1, CEN4 and Tetrahymena
CC   telomeric elements.
CC   A yeast artificial chromosome vector for cloning blunt-ended
CC   fragments.
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pYAC2)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (yeast artificial chromosome)
CC   SP (ATCC)
CC   HO (E.coli RR1)(Saccharomyces cerevisiae)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (YIp5)(YCp19)(yeast sup4-o gene)(lambda)(yeast telomere)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. YIp5 AvaI 5541bp 2541..2541, URA3 gene
FT                   fill in
FT                   -> plasmid 5541bp [no SmaI at 2543 in URA3]
FT                   1. plasmid EcoRI-PvuII 3248bp 2..3250, pBR322 part
FT                   :Klenow
FT                   2. YCp19 PvuII 10600bp 4711..4711, ARS1/TRP1/CEN4
FT                   -> pPM662 11600bp
FT                   \ [PvuII, ori, amp, ARS1, TRP1, CEN4, URA3]
FT                   1. yeast, sup4-o gene
FT                   -> pSU4-A
FT                   1. pPM662 BamHI 11600bp, YRp17 1840..1840
FT                   fill in
FT                   2. pSU4-A AluI-AluI 262bp, SUP4-o gene
FT                   \ 42bp
FT                   \ aattccctttagtataaatttcactctgaaccatcttggaag
FT                   \ #J01381 202bp
FT                   \ gaccggataattatttgaaatgtgtttttcaattgtatatgtgttatgta
FT                   \ gtatactctttcttcaacaattaaatactctcggtagccaagttggttta
FT                   \ aggcgcaagactttaatttatcactacgaaatcttgagatcgggcgttcg
FT                   \ actcgcccccgggagatttttttgttttttatgtctccattcacttcccaga
FT                   \ 33bp
FT                   \ cttgcaagttgaaatatttctttcaagggaatt
FT                   SfiI-NotI linker 17bp gcggccgcsgcggccgc:NotI-SfiI
FT                   \ linker 17bp gcggccgcsgcggccgc
FT                   -> pPM664 11900bp
FT                   1. pPM664 remove EcoRI-KpnI 3600bp, CEN4/YIp5 EcoRI 2
FT                   \ 8285bp
FT                   Klenow:Klenow
FT                   -> plasmid 8285bp
FT                   1. plasmid EcoRI 8285bp, CEN4/YIp5 EcoRI 2
FT                   fill in
FT                   -> pPM668 8285bp [no XhoI in CEN4]
FT                   1. lambda BamHI 48502bp,
FT                   \ 5506 22347 27973 34500 41733
FT                   2. yeast BamHI-BamHI, telomere
FT                   3. pYAC4 BamHI-BamHI 1768bp 4238..6006, HIS3 gene
FT                   4. yeast BamHI-BamHI, telomere
FT                   -> A240p1
FT                   1. pPM668 PvuII 8285bp, pBR322 part/YIp5 3250
FT                   2. A240p1, telomere/HIS3/telomere
FT                   XhoI linker 6bp ctcgag:XhoI linker 6bp ctcgag
FT                   XhoI-XhoI 3178bp, telomere/HIS3/telomere
FT                   \ pYAC4 3178bp 3533..6711
FT                   -> pYAC2 11420bp [11100bp; like pYAC4]"
FT   -               1..296
FT                   /note="pYAC4 1..296 296bp
FT                   SfiI =    GGCCNNNN^NGGCC
FT                   NotI = GC^GGCCGC
FT                   \      gcggccgcsgcggccgc"
FT   -               297..313
FT                   /note="gcggccgcsgcggccgc 17bp
FT                   \      gcggccgcsgcggccgc
FT                   NotI = GC^GGCCGC
FT                   SfiI =    GGCCNNNN^NGGCC"
FT   -               314..559
FT                   /note="pYAC4 307..552 246bp"
FT   -               560..562
FT                   /note="gaa 3bp"
FT   -               563..691
FT                   /note="pYAC4 564..692 129bp
FT                   SfiI =    GGCCNNNN^NGGCC
FT                   NotI = GC^GGCCGC
FT                   \      gcggccgcsgcggccgc"
FT   -               692..708
FT                   /note="gcggccgcsgcggccgc 17bp
FT                   \      gcggccgcsgcggccgc
FT                   NotI = GC^GGCCGC
FT                   SfiI =    GGCCNNNN^NGGCC"
FT   -               709..11463
FT                   /note="pYAC4 700..11454 10755bp"
FT   misc_binding    0..0
FT                   /note="SIT unique SmaI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   rep_origin      0..0
FT                   /note="ORI yeast ARS1"
FT   misc_feature    0..0
FT                   /note="yeast centromere CEN4"
FT   CDS             0..0
FT                   /note="ANT yeast HIS3 gene"
FT   CDS             0..0
FT                   /note="ANT yeast SUP4 gene (ochre suppressor)"
FT   CDS             0..0
FT                   /note="ANT yeast TRP1 gene"
FT   CDS             0..0
FT                   /note="ANT yeast URA3 gene"
XX
SQ   Sequence 11463 BP; 3148 A; 2554 C; 2574 G; 3185 T; 2 other;
     ttctcatgtt tgacagctta tcatcgataa gctttaatgc ggtagtttat cacagttaaa
     ttgctaacgc agtcaggcac cgtgtatgaa atctaacaat gcgctcatcg tcatcctcgg
     caccgtcacc ctggatgctg taggcatagg cttggttatg ccggtactgc cgggcctctt
     gcgggatatc gtccattccg acagcatcgc cagtcactat ggcgtgctgc tagcgctata
     tgcgttgatg caatttctat gcgcacccgt tctcggagca ctgtccgacc gctttggcgg
     ccgcsgcggc cgcagtcctg ctcgcttcgc tacttggagc cactatcgac tacgcgatca
     tggcgaccac acccgtcctg tggatcaatt ccctttagta taaatttcac tctgaaccat
     cttggaagga ccggtaatta tttcaaatct ctttttcaat tgtatatgtg ttatgttatg
     tagtatactc tttcttcaac aattaaatac tctcggtagc caagttggtt taaggcgcaa
     gactttaatt tatcactacg aaatcttgag atcgggcgtt cgatcgcccc gggagatttt
     tttgtttttt atgtcttcca ttcacttccc agacttgcaa gttgaaatat ttctttcaag
     ggaattgatc ctctacgccg gacgcatcgt ggcggccgcs gcggccgctc accggcgcca
     caggtgcggt tgctggcgcc tatatcgccg acatcaccga tggggaagat cgggctcgcc
     acttcgggct catgagcgct tgtttcggcg tgggtatggt ggcaggcccc gtggccgggg
     gactgttggg cgccatctcc ttgcatgcac cattccttgc ggcggcggtg ctcaacggcc
     tcaacctact actgggctgc ttcctaatgc aggagtcgca taagggagag cgtcgaccga
     tgcccttgag agccttcaac ccagtcagct ccttccggtg ggcgcggggc atgactatcg
     tcgccgcact tatgactgtc ttctttatca tgcaactcgt aggacaggtg ccggcagcgc
     tctgggtcat tttcggcgag gaccgctttc gctggagcgc gacgatgatc ggcctgtcgc
     ttgcggtatt cggaatcttg cacgccctcg ctcaagcctt cgtcactggt cccgccacca
     aacgtttcgg cgagaagcag gccattatcg ccggcatggc ggccgacgcg ctgggctacg
     tcttgctggc gttcgcgacg cgaggctgga tggccttccc cattatgatt cttctcgctt
     ccggcggcat cgggatgccc gcgttgcagg ccatgctgtc caggcaggta gatgacgacc
     atcagggaca gcttcaagga tcgctcgcgg ctcttaccag cctaacttcg atcactggac
     cgctgatcgt cacggcgatt tatgccgcct cggcgagcac atggaacggg ttggcatgga
     ttgtaggcgc cgccctatac cttgtctgcc tccccgcgtt gcgtcgcggt gcatggagcc
     gggccacctc gacctgaatg gaagccggcg gcacctcgct aacggattca ccactccaag
     aattggagcc aatcaattct tgcggagaac tgtgaatgcg caaaccaacc cttggcagaa
     catatccatc gcgtccgcca tctccagcag ccgcacgcgg cgcatccccc cccccctttc
     aattcaattc atcatttttt ttttattctt ttttttgatt tcggtttctt tgaaattttt
     ttgattcggt aatctccgaa cagaaggaag aacgaaggaa ggagcacaga cttagattgg
     tatatatacg catatgtagt gttgaagaaa catgaaattg cccagtattc ttaacccaac
     tgcacagaac aaaaacctgc aggaaacgaa gataaatcat gtcgaaagct acatataagg
     aacgtgctgc tactcatcct agtcctgttg ctgccaagct atttaatatc atgcacgaaa
     agcaaacaaa cttgtgtgct tcattggatg ttcgtaccac caaggaatta ctggagttag
     ttgaagcatt aggtcccaaa atttgtttac taaaaacaca tgtggatatc ttgactgatt
     tttccatgga gggcacagtt aagccgctaa aggcattatc cgccaagtac aattttttac
     tcttcgaaga cagaaaattt gctgacattg gtaatacagt caaattgcag tactctgcgg
     gtgtatacag aatagcagaa tgggcagaca ttacgaatgc acacggtgtg gtgggcccag
     gtattgttag cggtttgaag caggcggcag aagaagtaac aaaggaacct agaggccttt
     tgatgttagc agaattgtca tgcaagggct ccctatctac tggagaatat actaagggta
     ctgttgacat tgcgaagagc gacaaagatt ttgttatcgg ctttattgct caaagagaca
     tgggtggaag agatgaaggt tacgattggt tgattatgac acccggtgtg ggtttagatg
     acaagggaga cgcattgggt caacagtata gaaccgtgga tgatgtggtc tctacaggat
     ctgacattat tattgttgga agaggactat ttgcaaaggg aagggatgct aaggtagagg
     gtgaacgtta cagaaaagca ggctgggaag catatttgag aagatgcggc cagcaaaact
     aaaaaactgt attataagta aatgcatgta tactaaactc acaaattaga gcttcaattt
     aattatatca gttattactc gggcgtaatg atttttataa tgacgaaaaa aaaaaaattg
     gaaagaaaag gggggggggg cagcgttggg tcctggccac gggtgcgcat gatcgtgctc
     ctgtcgttga ggacccggct aggctggcgg ggttgcctta ctggttagca gaatgaatca
     ccgatacgcg agcgaacgtg aagcgactgc tgctgcaaaa cgtctgcgac ctgagcaaca
     acatgaatgg tcttcggttt ccgtgtttcg taaagtctgg aaacgcggaa gtcagcgccc
     tgcaccatta tgttccggat ctgcatcgca ggatgctgct ggctaccctg tggaacacct
     acatctgtat taacgaagcg ctggcattga ccctgagtga tttttctctg gtcccgccgc
     atccataccg ccagttgttt accctcacaa cgttccagta accgggcatg ttcatcatca
     gtaacccgta tcgtgagcat cctctctcgt ttcatcggta tcattacccc catgaacaga
     aattccccct tacacggagg catcaagtga ccaaacagga aaaaaccgcc cttaacatgg
     cccgctttat cagaagccag acattaacgc ttctggagaa actcaacgag ctggacgcgg
     atgaacaggc agacatctgt gaatcgcttc acgaccacgc tgatgagctt taccgcagcc
     ctcgagggat aagcttcatt tttagataaa atttattaat catcattaat ttcttgaaaa
     acattttatt tattgatctt ttataacaaa aaacccttct aaaagtttat ttttgaatga
     aaaacttata aaaatttatg aaaactacaa aaaataaaat ttttaattaa aataattttg
     ataagaactt caatctttga ctagctagct tagtcatttt tgagatttaa ttaatatttt
     atgtttattc atatataaac tattcaaaat attatagaat ttaaacattt taacatctta
     atcattcata aataactaaa aatcaaagta ttacatcaat aaataacttt tactcaatgt
     caaagaatta ttggggttgg ggttggggtt ggggttgggg ttggggttgg ggttggggtt
     ggggttgggg ttggggttgg ggttggggtt ggggttgggg ttggggttgg ggttggggtt
     ggggttgggg ttggggttgg ggttggggtt ggggttgggg ttggggttgg ggttggggtt
     ggggttgggg ttggggttgg ggttggggtt ggggttgggg ttggggttgg ggttggggtt
     ggggttgggg ttggggttgg ggttggggtt ggggttgggg tgggaaaaca gcattcaggt
     attagaagaa tatcctgatt caggtgaaaa tattgttgat gcgcgggatc ctcggggaca
     ccaaatatgg cgatctcggc cttttcgttt cttggagctg ggacatgttt gccatcgatc
     catctaccac cagaacggcc gttagatctg ctgccaccgt tgtttccacc gaagaaacca
     ccgttgccgt aaccaccacg acggttgttg ctaaagaagc tgccaccgcc acggccaccg
     ttgtagccgc cgttgttgtt attgtagttg ctcatgttat ttctggcact tcttggtttt
     cctcttaagt gaggaggaac ataaccattc tcgttgttgt cgttgatgct taaattttgc
     acttgttcgc tcagttcagc cataatatga aatgcttttc ttgttgttct tacggaatac
     cacttgccac ctatcaccac aactaacttt ttcccgttcc tccatctctt ttatattttt
     tttctcgatc gagttcaaga gaaaaaaaaa gaaaaagcaa aaagaaaaaa ggaaagcgcg
     cctcgttcag aatgacacgt atagaatgat gcattacctt gtcatcttca gtatcatact
     gttcgtatac atacttactg acattcatag gtatacatat atacacatgt atatatatcg
     tatgctgcag ctttaaataa tcggtgtcac tacataagaa cacctttggt ggagggaaca
     tcgttggtac cattgggcga ggtggcttct cttatggcaa ccgcaagagc cttgaacgca
     ctctcactac ggtgatgatc attcttgcct cgcagacaat caacgtggag ggtaattctg
     ctagcctctg caaagctttc aagaaaatgc gggatcatct cgcaagagag atctcctact
     ttctcccttt gcaaaccaag ttcgacaact gcgtacggcc tgttcgaaag atctaccacc
     gctctggaaa gtgcctcatc caaaggcgca aatcctgatc caaacctttt tactccacgc
     gccagtaggg cctctttaaa agcttgaccg agagcaatcc cgcagtcttc agtggtgtga
     tggtcgtcta tgtgtaagtc accaatgcac tcaacgatta gcgaccagcc ggaatgcttg
     gccagagcat gtatcatatg gtccagaaac cctatacctg tgtggacgtt aatcacttgc
     gattgtgtgg cctgttctgc tactgcttct gcctcttttt ctgggaagat cgagtgctct
     atcgctaggg gaccaccctt taaagagatc gcaatctgaa tcttggtttc atttgtaata
     cgctttacta gggctttctg ctctgtcatc tttgccttcg tttatcttgc ctgctcattt
     tttagtatat tcttcgaaga aatcacatta ctttatataa tgtataattc attatgtgat
     aatgccaatc gctaagaaaa aaaaagagtc atccgctagg tggaaaaaaa aaaatgaaaa
     tcattaccga ggcataaaaa aatatagagt gtactagagg aggccaagag taatagaaaa
     agaaaattgc gggaaaggac tgtgttatga cttccctgac taatgccgtg ttcaaacgat
     acctggcagt gactcctagc gctcaccaag ctcttaaaac gagaattaag aaaaagtcgt
     catctttcga taagtttttc ccacagcaaa gcaatagtag aaaaaaacaa tgggaaacgt
     tgaatgaaga caaagcgtcg tggtttaaaa ggaaatacgc tcacgtacat gctagggaac
     aggaccgtgc agcggatccc gcgcatcaac aatattttca cctgaatcag gatattcttc
     taatacctga atgctgtttt cccaccccaa ccccaacccc aaccccaacc ccaaccccaa
     ccccaacccc aaccccaacc ccaaccccaa ccccaacccc aaccccaacc ccaaccccaa
     ccccaacccc aaccccaacc ccaaccccaa ccccaacccc aaccccaacc ccaaccccaa
     ccccaacccc aaccccaacc ccaaccccaa ccccaacccc aaccccaacc ccaaccccaa
     ccccaacccc aaccccaacc ccaaccccaa ccccaacccc aaccccaacc ccaataattc
     tttgacattg agtaaaagtt atttattgat gtaatacttt gatttttagt tatttatgaa
     tgattaagat gttaaaatgt ttaaattcta taatattttg aatagtttat atatgaataa
     acataaaata ttaattaaat ctcaaaaatg actaagctag ctagtcaaag attgaagttc
     ttatcaaaat tattttaatt aaaaatttta ttttttgtag ttttcataaa tttttataag
     tttttcattc aaaaataaac ttttagaagg gttttttgtt ataaaagatc aataaataaa
     atgtttttca agaaattaat gatgattaat aaattttatc taaaaatgaa gcttatccct
     cgagggctgc ctcgcgcgtt tcggtgatga cggtgaaaac ctctgacaca tgcagctccc
     ggagacggtc acagcttgtc tgtaagcgga tgccgggagc agacaagccc gtcagggcgc
     gtcagcgggt gttggcgggt gtcggggcgc agccatgacc cagtcacgta gcgatagcgg
     agtgtatact ggcttaacta tgcggcatca gagcagattg tactgagagt gcaccatatg
     cggtgtgaaa taccgcacag atgcgtaagg agaaaatacc gcatcaggcg ctcttccgct
     tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac
     tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga
     gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat
     aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac
     ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct
     gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg
     ctttctcata gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg
     ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt
     cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg
     attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac
     ggctacacta gaaggacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga
     aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggttttttt
     gtttgcaagc agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt
     tctacggggt ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaga
     ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa aatgaagttt taaatcaatc
     taaagtatat atgagtaaac ttggtctgac agttaccaat gcttaatcag tgaggcacct
     atctcagcga tctgtctatt tcgttcatcc atagttgcct gactccccgt cgtgtagata
     actacgatac gggagggctt accatctggc cccagtgctg caatgatacc gcgagaccca
     cgctcaccgg ctccagattt atcagcaata aaccagccag ccggaagggc cgagcgcaga
     agtggtcctg caactttatc cgcctccatc cagtctatta attgttgccg ggaagctaga
     gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg ccattgctgc aggcatcgtg
     gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg gttcccaacg atcaaggcga
     gttacatgat cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt
     gtcagaagta agttggccgc agtgttatca ctcatggtta tggcagcact gcataattct
     cttactgtca tgccatccgt aagatgcttt tctgtgactg gtgagtactc aaccaagtca
     ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaac acgggataat
     accgcgccac atagcagaac tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga
     aaactctcaa ggatcttacc gctgttgaga tccagttcga tgtaacccac tcgtgcaccc
     aactgatctt cagcatcttt tactttcacc agcgtttctg ggtgagcaaa aacaggaagg
     caaaatgccg caaaaaaggg aataagggcg acacggaaat gttgaatact catactcttc
     ctttttcaat attattgaag catttatcag ggttattgtc tcatgagcgg atacatattt
     gaatgtattt agaaaaataa acaaataggg gttccgcgca catttccccg aaaagtgcca
     cctgacgtct aagaaaccat tattatcatg acattaacct ataaaaatag gcgtatcacg
     aggccctttc gtcttcaaga attaattcgg tcgaaaaaag aaaaggagag ggccaagagg
     gagggcattg gtgactattg agcacgtgag tatacgtgat taagcacaca aaggcagctt
     ggagtatgtc tgttattaat ttcacaggta gttctggtcc attggtgaaa gtttgcggct
     tgcagagcac agaggccgca gaatgtgctc tagattccga tgctgacttg ctgggtatta
     tatgtgtgcc caatagaaag agaacaattg acccggttat tgcaaggaaa atttcaagtc
     ttgtaaaagc atataaaaat agttcaggca ctccgaaata cttggttggc gtgtttcgta
     atcaacctaa ggaggatgtt ttggctctgg tcaatgatta cggcattgat atcgtccaac
     tgcatggaga tgagtcgtgg caagaatacc aagagttcct cggtttgcca gttattaaaa
     gactcgtatt tccaaaagac tgcaacatac tactcagtgc agcttcacag aaacctcatt
     cgtttattcc cttgtttgat tcagaagcag gtgggacagg tgaacttttg gattggaact
     cgatttctga ctgggttgga aggcaagaga gccccgaaag cttacatttt atgttagctg
     gtggactgac gccagaaaat gttggtgatg cgcttagatt aaatggcgtt attggtgttg
     atgtaagcgg aggtgtggag acaaatggtg taaaagactc taacaaaata gcaaatttcg
     tcaaaaatgc taagaaatag gttattactg agtagtattt atttaagtat tgtttgtgca
     cttgcctgca ggccttttga aaagcaagca taaaagatct aaacataaaa tctgtaaaat
     aacaagatgt aaagataatg ctaaatcatt tggctttttg attgattgta caggaaaata
     tacatcgcag ggggttgact tttaccattt caccgcaatg gaatcaaact tgttgaagag
     aatgttcaca ggcgcatacg ctacaatgac ccgattcttg ctagcctttt ctcggtcttg
     caaacaaccg ccggcagctt agtatataaa tacacatgta catacctctc tccgtatcct
     cgtaatcatt ttcttgtatt tatcgtcttt tcgctgtaaa aactttatca cacttatctc
     aaatacactt attaaccgct tttactatta tcttctacgc tgacagtaat atcaaacagt
     gacacatatt aaacacagtg gtttctttgc ataaacacca tcagcctcaa gtcgtcaagt
     aaagatttcg tgttcatgca gatagataac aatctatatg ttgataatta gcgttgcctc
     atcaatgcga gatccgttta accggaccct agtgcactta ccccacgttc ggtccactgt
     gtgccgaaca tgctccttca ctattttaac atgtggaatt aattctaaat cctctttata
     tgatctgccg atagatagtt ctaagtcatt gaggttcatc aacaattgga ttttctgttt
     actcgacttc aggtaaatga aatgagatga tacttgctta tctcatagtt aactctaaga
     ggtgatactt atttactgta aaactgtgac gataaaaccg gaaggaagaa taagaaaact
     cgaactgatc tataatgcct attttctgta aagagtttaa gctatgaaag cctcggcatt
     ttggccgctc ctaggtagtg ctttttttcc aaggacaaaa cagtttcttt ttcttgagca
     ggttttatgt ttcggtaatc ataaacaata aataaattat ttcatttatg tttaaaaata
     aaaaataaaa aagtatttta aatttttaaa aaagttgatt ataagcatgt gaccttttgc
     aagcaattaa attttgcaat ttgtgatttt aggcaaaagt tacaatttct ggctcgtgta
     atatatgtat gctaaagtga acttttacaa agtcgatatg gacttagtca aaagaaattt
     tcttaaaaat atatagcact agccaattta gcacttcttt atgagatata ttatagactt
     tattaagcca gatttgtgta ttatatgtat ttacccggcg aatcatggac atacattctg
     aaataggtaa tattctctat ggtgagacag catagataac ctaggataca agttaaaagc
     tagtactgtt ttgcagtaat ttttttcttt tttataagaa tgttaccacc taaataagtt
     ataaagtcaa tagttaagtt tgatatttga ttgtaaaata ccgtaatata tttgcatgat
     caaaaggctc aatgttgact agccagcatg tcaaccacta tattgatcac cgatatatgg
     acttccacac caactagtaa tatgacaata aattcaagat attcttcatg agaatggccc
     aga
//