back Return to this vector's summary.
ID   PYACRC     preliminary; circular DNA; SYN; 11487 BP.
XX
AC   ATCC37610;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli YAC vector pYAC-RC - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pYAC-RC from pYAC3 & linker
RA   Marchuk D., Collins F.S.;
RT   "pYAC-RC, a yeast artificial chromosome vector for cloning DNA cut
RT   with infrequently cutting restriction endonucleases";
RL   Nucleic Acids Res. 16:7743-7743(1988).
XX
RN   [2]
RC   yHPRT from yeast YAC & human HPRT gene
RA   Jakobovits A., Moore A.L., Green L.L., Vergara G.J.,
RA   Maynard-Curtis C.E., Austin H.A., Klapholz S.;
RT   "Germ-line transmission and expression of a human-derived yeast
RT   artificial chromosome";
RL   Nature 362:255-258(1993).
XX
RN   [3]
RC   pJEF742 from yeast Ty repeat
RA   Boeke J.;
RT   ;
RL   Unpublished (1993).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   Due to ligation compatibility with sites in the polylinker, DNA
CC   fragments from BssHII, EagI, NaeI, NarI, NruI, SmaI and XhoI digests
CC   may also be cloned in this vector.
CC   Constructed by removing the ClaI and SalI sites from pYAC3 and
CC   inserting a polylinker in the SnaBI site within SUP4.  SUP4 still
CC   functions.
CC   A yeast artificial chromosome vector for genomic library construction
CC   using DNA digested with infrequent restriction enzymes.
CC   Restriction digests of the clone give the following sizes (kb):
CC   HindIII--3.7, 3.0, 1.9, 1.47; SalI--12.0. (ATCC staff)
CC   Digestion with HindIII gives the following sizes (kb): 3.5, 3.0, 1.9,
CC   1.4(doublet), small fragment.  If any telomere DNA has been deleted,
CC   the doublet will be resolved and a new band will appear. (personal
CC   communication)
CC   An occasional isolate will spontaneously delete small amounts of
CC   telomere sequence.  Check by digesting the plasmid with HindIII.
CC   (personal communication)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (pYAC-RC)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (yeast artificial chromosome)
CC   SP (ATCC)
CC   HO (E.coli MC1061)(Saccharomyces cerevisiae)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pYAC3)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pYAC3 ClaI 11448bp 25..25, may be 4307..4307
FT                   \ [11700bp]
FT                   fill in
FT                   SalI 11452bp 944..944
FT                   fill in
FT                   SnaBI 11460bp 554..554, SUP4 intron
FT                   2. linker NotI-SacII-SalI-MluI-ClaI-SnaBI 35bp
FT                   \ ctacgcggccgcggtcgacgcgtatcgatacgtaa
FT                   -> pYAC-RC 11495bp [11700bp]"
FT   -               1..26
FT                   /note="pYAC4 1..26 26bp
FT                   ClaI = AT^CG AT
FT                   ClaI =    AT^CGAT"
FT   -               27..554
FT                   /note="pYAC4 25..552 528bp
FT                   SnaBI = TAC^GTA
FT                   \           ctacgcg..."
FT   -               555..589
FT                   /note="35bp
FT                   \ ctacgcggccgcggtcgacgcgtatcgatacgtaa
FT                   \ ...acgtaa
FT                   SnaBI = TAC^GTA"
FT   -               590..976
FT                   /note="pYAC4 561..947 387bp
FT                   SalI = G^TCGA C
FT                   SalI =      G^TCGAC"
FT   -               977..11487
FT                   /note="pYAC4 944..11454 10511bp"
FT   misc_binding    0..0
FT                   /note="MCS NotI-SacII-SalI-MluI-ClaI-SnaBI-SmaI"
FT   misc_binding    0..0
FT                   /note="SIT unique NotI-SacII-SalI-MluI-ClaI-SnaBI-
FT                   SmaI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   rep_origin      0..0
FT                   /note="ORI yeast ARS1"
FT   misc_feature    0..0
FT                   /note="yeast centromere CEN4"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   CDS             0..0
FT                   /note="ANT yeast HIS3 gene"
FT   CDS             0..0
FT                   /note="ANT yeast SUP4 gene (ochre suppressor)"
FT   CDS             0..0
FT                   /note="ANT yeast TRP1 gene (tryptophan)"
FT   CDS             0..0
FT                   /note="ANT yeast URA3 gene"
XX
SQ   Sequence 11487 BP; 3156 A; 2561 C; 2577 G; 3193 T; 0 other;
     ttctcatgtt tgacagctta tcatcgcgat aagctttaat gcggtagttt atcacagtta
     aattgctaac gcagtcaggc accgtgtatg aaatctaaca atgcgctcat cgtcatcctc
     ggcaccgtca ccctggatgc tgtaggcata ggcttggtta tgccggtact gccgggcctc
     ttgcgggata tcgtccattc cgacagcatc gccagtcact atggcgtgct gctagcgcta
     tatgcgttga tgcaatttct atgcgcaccc gttctcggag cactgtccga ccgctttggc
     cgccgcccag tcctgctcgc ttcgctactt ggagccacta tcgactacgc gatcatggcg
     accacacccg tcctgtggat caattccctt tagtataaat ttcactctga accatcttgg
     aaggaccggt aattatttca aatctctttt tcaattgtat atgtgttatg ttatgtagta
     tactctttct tcaacaatta aatactctcg gtagccaagt tggtttaagg cgcaagactt
     taatttatca ctacctacgc ggccgcggtc gacgcgtatc gatacgtaag taatcttgag
     atcgggcgtt cgatcgcccc gggagatttt tttgtttttt atgtcttcca ttcacttccc
     agacttgcaa gttgaaatat ttctttcaag ggaattgatc ctctacgccg gacgcatcgt
     ggccggcatc accggcgcca caggtgcggt tgctggcgcc tatatcgccg acatcaccga
     tggggaagat cgggctcgcc acttcgggct catgagcgct tgtttcggcg tgggtatggt
     ggcaggcccc gtggccgggg gactgttggg cgccatctcc ttgcatgcac cattccttgc
     ggcggcggtg ctcaacggcc tcaacctact actgggctgc ttcctaatgc aggagtcgca
     taagggagag cgtcgatcga ccgatgccct tgagagcctt caacccagtc agctccttcc
     ggtgggcgcg gggcatgact atcgtcgccg cacttatgac tgtcttcttt atcatgcaac
     tcgtaggaca ggtgccggca gcgctctggg tcattttcgg cgaggaccgc tttcgctgga
     gcgcgacgat gatcggcctg tcgcttgcgg tattcggaat cttgcacgcc ctcgctcaag
     ccttcgtcac tggtcccgcc accaaacgtt tcggcgagaa gcaggccatt atcgccggca
     tggcggccga cgcgctgggc tacgtcttgc tggcgttcgc gacgcgaggc tggatggcct
     tccccattat gattcttctc gcttccggcg gcatcgggat gcccgcgttg caggccatgc
     tgtccaggca ggtagatgac gaccatcagg gacagcttca aggatcgctc gcggctctta
     ccagcctaac ttcgatcact ggaccgctga tcgtcacggc gatttatgcc gcctcggcga
     gcacatggaa cgggttggca tggattgtag gcgccgccct ataccttgtc tgcctccccg
     cgttgcgtcg cggtgcatgg agccgggcca cctcgacctg aatggaagcc ggcggcacct
     cgctaacgga ttcaccactc caagaattgg agccaatcaa ttcttgcgga gaactgtgaa
     tgcgcaaacc aacccttggc agaacatatc catcgcgtcc gccatctcca gcagccgcac
     gcggcgcatc cccccccccc tttcaattca attcatcatt ttttttttat tctttttttt
     gatttcggtt tctttgaaat ttttttgatt cggtaatctc cgaacagaag gaagaacgaa
     ggaaggagca cagacttaga ttggtatata tacgcatatg tagtgttgaa gaaacatgaa
     attgcccagt attcttaacc caactgcaca gaacaaaaac ctgcaggaaa cgaagataaa
     tcatgtcgaa agctacatat aaggaacgtg ctgctactca tcctagtcct gttgctgcca
     agctatttaa tatcatgcac gaaaagcaaa caaacttgtg tgcttcattg gatgttcgta
     ccaccaagga attactggag ttagttgaag cattaggtcc caaaatttgt ttactaaaaa
     cacatgtgga tatcttgact gatttttcca tggagggcac agttaagccg ctaaaggcat
     tatccgccaa gtacaatttt ttactcttcg aagacagaaa atttgctgac attggtaata
     cagtcaaatt gcagtactct gcgggtgtat acagaatagc agaatgggca gacattacga
     atgcacacgg tgtggtgggc ccaggtattg ttagcggttt gaagcaggcg gcagaagaag
     taacaaagga acctagaggc cttttgatgt tagcagaatt gtcatgcaag ggctccctat
     ctactggaga atatactaag ggtactgttg acattgcgaa gagcgacaaa gattttgtta
     tcggctttat tgctcaaaga gacatgggtg gaagagatga aggttacgat tggttgatta
     tgacacccgg tgtgggttta gatgacaagg gagacgcatt gggtcaacag tatagaaccg
     tggatgatgt ggtctctaca ggatctgaca ttattattgt tggaagagga ctatttgcaa
     agggaaggga tgctaaggta gagggtgaac gttacagaaa agcaggctgg gaagcatatt
     tgagaagatg cggccagcaa aactaaaaaa ctgtattata agtaaatgca tgtatactaa
     actcacaaat tagagcttca atttaattat atcagttatt actcgggcgt aatgattttt
     ataatgacga aaaaaaaaaa attggaaaga aaaggggggg ggggcagcgt tgggtcctgg
     ccacgggtgc gcatgatcgt gctcctgtcg ttgaggaccc ggctaggctg gcggggttgc
     cttactggtt agcagaatga atcaccgata cgcgagcgaa cgtgaagcga ctgctgctgc
     aaaacgtctg cgacctgagc aacaacatga atggtcttcg gtttccgtgt ttcgtaaagt
     ctggaaacgc ggaagtcagc gccctgcacc attatgttcc ggatctgcat cgcaggatgc
     tgctggctac cctgtggaac acctacatct gtattaacga agcgctggca ttgaccctga
     gtgatttttc tctggtcccg ccgcatccat accgccagtt gtttaccctc acaacgttcc
     agtaaccggg catgttcatc atcagtaacc cgtatcgtga gcatcctctc tcgtttcatc
     ggtatcatta cccccatgaa cagaaattcc cccttacacg gaggcatcaa gtgaccaaac
     aggaaaaaac cgcccttaac atggcccgct ttatcagaag ccagacatta acgcttctgg
     agaaactcaa cgagctggac gcggatgaac aggcagacat ctgtgaatcg cttcacgacc
     acgctgatga gctttaccgc agccctcgag ggataagctt catttttaga taaaatttat
     taatcatcat taatttcttg aaaaacattt tatttattga tcttttataa caaaaaaccc
     ttctaaaagt ttatttttga atgaaaaact tataaaaatt tatgaaaact acaaaaaata
     aaatttttaa ttaaaataat tttgataaga acttcaatct ttgactagct agcttagtca
     tttttgagat ttaattaata ttttatgttt attcatatat aaactattca aaatattata
     gaatttaaac attttaacat cttaatcatt cataaataac taaaaatcaa agtattacat
     caataaataa cttttactca atgtcaaaga attattgggg ttggggttgg ggttggggtt
     ggggttgggg ttggggttgg ggttggggtt ggggttgggg ttggggttgg ggttggggtt
     ggggttgggg ttggggttgg ggttggggtt ggggttgggg ttggggttgg ggttggggtt
     ggggttgggg ttggggttgg ggttggggtt ggggttgggg ttggggttgg ggttggggtt
     ggggttgggg ttggggttgg ggttggggtt ggggttgggg ttggggttgg ggttggggtt
     ggggtgggaa aacagcattc aggtattaga agaatatcct gattcaggtg aaaatattgt
     tgatgcgcgg gatcctcggg gacaccaaat atggcgatct cggccttttc gtttcttgga
     gctgggacat gtttgccatc gatccatcta ccaccagaac ggccgttaga tctgctgcca
     ccgttgtttc caccgaagaa accaccgttg ccgtaaccac cacgacggtt gttgctaaag
     aagctgccac cgccacggcc accgttgtag ccgccgttgt tgttattgta gttgctcatg
     ttatttctgg cacttcttgg ttttcctctt aagtgaggag gaacataacc attctcgttg
     ttgtcgttga tgcttaaatt ttgcacttgt tcgctcagtt cagccataat atgaaatgct
     tttcttgttg ttcttacgga ataccacttg ccacctatca ccacaactaa ctttttcccg
     ttcctccatc tcttttatat tttttttctc gatcgagttc aagagaaaaa aaaagaaaaa
     gcaaaaagaa aaaaggaaag cgcgcctcgt tcagaatgac acgtatagaa tgatgcatta
     ccttgtcatc ttcagtatca tactgttcgt atacatactt actgacattc ataggtatac
     atatatacac atgtatatat atcgtatgct gcagctttaa ataatcggtg tcactacata
     agaacacctt tggtggaggg aacatcgttg gtaccattgg gcgaggtggc ttctcttatg
     gcaaccgcaa gagccttgaa cgcactctca ctacggtgat gatcattctt gcctcgcaga
     caatcaacgt ggagggtaat tctgctagcc tctgcaaagc tttcaagaaa atgcgggatc
     atctcgcaag agagatctcc tactttctcc ctttgcaaac caagttcgac aactgcgtac
     ggcctgttcg aaagatctac caccgctctg gaaagtgcct catccaaagg cgcaaatcct
     gatccaaacc tttttactcc acgcgccagt agggcctctt taaaagcttg accgagagca
     atcccgcagt cttcagtggt gtgatggtcg tctatgtgta agtcaccaat gcactcaacg
     attagcgacc agccggaatg cttggccaga gcatgtatca tatggtccag aaaccctata
     cctgtgtgga cgttaatcac ttgcgattgt gtggcctgtt ctgctactgc ttctgcctct
     ttttctggga agatcgagtg ctctatcgct aggggaccac cctttaaaga gatcgcaatc
     tgaatcttgg tttcatttgt aatacgcttt actagggctt tctgctctgt catctttgcc
     ttcgtttatc ttgcctgctc attttttagt atattcttcg aagaaatcac attactttat
     ataatgtata attcattatg tgataatgcc aatcgctaag aaaaaaaaag agtcatccgc
     taggtggaaa aaaaaaaatg aaaatcatta ccgaggcata aaaaaatata gagtgtacta
     gaggaggcca agagtaatag aaaaagaaaa ttgcgggaaa ggactgtgtt atgacttccc
     tgactaatgc cgtgttcaaa cgatacctgg cagtgactcc tagcgctcac caagctctta
     aaacgagaat taagaaaaag tcgtcatctt tcgataagtt tttcccacag caaagcaata
     gtagaaaaaa acaatgggaa acgttgaatg aagacaaagc gtcgtggttt aaaaggaaat
     acgctcacgt acatgctagg gaacaggacc gtgcagcgga tcccgcgcat caacaatatt
     ttcacctgaa tcaggatatt cttctaatac ctgaatgctg ttttcccacc ccaaccccaa
     ccccaacccc aaccccaacc ccaaccccaa ccccaacccc aaccccaacc ccaaccccaa
     ccccaacccc aaccccaacc ccaaccccaa ccccaacccc aaccccaacc ccaaccccaa
     ccccaacccc aaccccaacc ccaaccccaa ccccaacccc aaccccaacc ccaaccccaa
     ccccaacccc aaccccaacc ccaaccccaa ccccaacccc aaccccaacc ccaaccccaa
     ccccaacccc aaccccaata attctttgac attgagtaaa agttatttat tgatgtaata
     ctttgatttt tagttattta tgaatgatta agatgttaaa atgtttaaat tctataatat
     tttgaatagt ttatatatga ataaacataa aatattaatt aaatctcaaa aatgactaag
     ctagctagtc aaagattgaa gttcttatca aaattatttt aattaaaaat tttatttttt
     gtagttttca taaattttta taagtttttc attcaaaaat aaacttttag aagggttttt
     tgttataaaa gatcaataaa taaaatgttt ttcaagaaat taatgatgat taataaattt
     tatctaaaaa tgaagcttat ccctcgaggg ctgcctcgcg cgtttcggtg atgacggtga
     aaacctctga cacatgcagc tcccggagac ggtcacagct tgtctgtaag cggatgccgg
     gagcagacaa gcccgtcagg gcgcgtcagc gggtgttggc gggtgtcggg gcgcagccat
     gacccagtca cgtagcgata gcggagtgta tactggctta actatgcggc atcagagcag
     attgtactga gagtgcacca tatgcggtgt gaaataccgc acagatgcgt aaggagaaaa
     taccgcatca ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg
     ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac agaatcaggg
     gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag
     gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga
     cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct
     ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc
     tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta tctcagttcg
     gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc
     tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca
     ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag
     ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg tatctgcgct
     ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc
     accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga
     tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca
     cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat ccttttaaat
     taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc tgacagttac
     caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc atccatagtt
     gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc tggccccagt
     gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc aataaaccag
     ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc catccagtct
     attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt gcgcaacgtt
     gttgccattg ctgcaggcat cgtggtgtca cgctcgtcgt ttggtatggc ttcattcagc
     tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa aaaagcggtt
     agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt atcactcatg
     gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg cttttctgtg
     actggtgagt actcaaccaa gtcattctga gaatagtgta tgcggcgacc gagttgctct
     tgcccggcgt caacacggga taataccgcg ccacatagca gaactttaaa agtgctcatc
     attggaaaac gttcttcggg gcgaaaactc tcaaggatct taccgctgtt gagatccagt
     tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttacttt caccagcgtt
     tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag ggcgacacgg
     aaatgttgaa tactcatact cttccttttt caatattatt gaagcattta tcagggttat
     tgtctcatga gcggatacat atttgaatgt atttagaaaa ataaacaaat aggggttccg
     cgcacatttc cccgaaaagt gccacctgac gtctaagaaa ccattattat catgacatta
     acctataaaa ataggcgtat cacgaggccc tttcgtcttc aagaattaat tcggtcgaaa
     aaagaaaagg agagggccaa gagggagggc attggtgact attgagcacg tgagtatacg
     tgattaagca cacaaaggca gcttggagta tgtctgttat taatttcaca ggtagttctg
     gtccattggt gaaagtttgc ggcttgcaga gcacagaggc cgcagaatgt gctctagatt
     ccgatgctga cttgctgggt attatatgtg tgcccaatag aaagagaaca attgacccgg
     ttattgcaag gaaaatttca agtcttgtaa aagcatataa aaatagttca ggcactccga
     aatacttggt tggcgtgttt cgtaatcaac ctaaggagga tgttttggct ctggtcaatg
     attacggcat tgatatcgtc caactgcatg gagatgagtc gtggcaagaa taccaagagt
     tcctcggttt gccagttatt aaaagactcg tatttccaaa agactgcaac atactactca
     gtgcagcttc acagaaacct cattcgttta ttcccttgtt tgattcagaa gcaggtggga
     caggtgaact tttggattgg aactcgattt ctgactgggt tggaaggcaa gagagccccg
     aaagcttaca ttttatgtta gctggtggac tgacgccaga aaatgttggt gatgcgctta
     gattaaatgg cgttattggt gttgatgtaa gcggaggtgt ggagacaaat ggtgtaaaag
     actctaacaa aatagcaaat ttcgtcaaaa atgctaagaa ataggttatt actgagtagt
     atttatttaa gtattgtttg tgcacttgcc tgcaggcctt ttgaaaagca agcataaaag
     atctaaacat aaaatctgta aaataacaag atgtaaagat aatgctaaat catttggctt
     tttgattgat tgtacaggaa aatatacatc gcagggggtt gacttttacc atttcaccgc
     aatggaatca aacttgttga agagaatgtt cacaggcgca tacgctacaa tgacccgatt
     cttgctagcc ttttctcggt cttgcaaaca accgccggca gcttagtata taaatacaca
     tgtacatacc tctctccgta tcctcgtaat cattttcttg tatttatcgt cttttcgctg
     taaaaacttt atcacactta tctcaaatac acttattaac cgcttttact attatcttct
     acgctgacag taatatcaaa cagtgacaca tattaaacac agtggtttct ttgcataaac
     accatcagcc tcaagtcgtc aagtaaagat ttcgtgttca tgcagataga taacaatcta
     tatgttgata attagcgttg cctcatcaat gcgagatccg tttaaccgga ccctagtgca
     cttaccccac gttcggtcca ctgtgtgccg aacatgctcc ttcactattt taacatgtgg
     aattaattct aaatcctctt tatatgatct gccgatagat agttctaagt cattgaggtt
     catcaacaat tggattttct gtttactcga cttcaggtaa atgaaatgag atgatacttg
     cttatctcat agttaactct aagaggtgat acttatttac tgtaaaactg tgacgataaa
     accggaagga agaataagaa aactcgaact gatctataat gcctattttc tgtaaagagt
     ttaagctatg aaagcctcgg cattttggcc gctcctaggt agtgcttttt ttccaaggac
     aaaacagttt ctttttcttg agcaggtttt atgtttcggt aatcataaac aataaataaa
     ttatttcatt tatgtttaaa aataaaaaat aaaaaagtat tttaaatttt taaaaaagtt
     gattataagc atgtgacctt ttgcaagcaa ttaaattttg caatttgtga ttttaggcaa
     aagttacaat ttctggctcg tgtaatatat gtatgctaaa gtgaactttt acaaagtcga
     tatggactta gtcaaaagaa attttcttaa aaatatatag cactagccaa tttagcactt
     ctttatgaga tatattatag actttattaa gccagatttg tgtattatat gtatttaccc
     ggcgaatcat ggacatacat tctgaaatag gtaatattct ctatggtgag acagcataga
     taacctagga tacaagttaa aagctagtac tgttttgcag taattttttt cttttttata
     agaatgttac cacctaaata agttataaag tcaatagtta agtttgatat ttgattgtaa
     aataccgtaa tatatttgca tgatcaaaag gctcaatgtt gactagccag catgtcaacc
     actatattga tcaccgatat atggacttcc acaccaacta gtaatatgac aataaattca
     agatattctt catgagaatg gcccaga
//