back Return to this vector's summary.
ID   PZP19      preliminary; circular DNA; SYN; 2739 BP.
XX
AC   X13074;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector pZP19 - complete, BsmI insertion.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-53
RC   pZP19 from pUC19 & oligo
RA   Pan Z.Q., Bostock C.J.;
RT   "A cloning vector allowing excision of inserts with original termini
RT   irrespective of their sequence";
RL   Nucleic Acids Res. 16:8182-8182(1988).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   oligonucleotide inserted at SmaI site of pUC19.
CC   MCS. oligonucleotide linker.
CC   NCBI gi: 58138
CC   NM (pZP19)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pUC19)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pUC19 SmaI 2686bp 415..415
FT                   2. oligo 53bp
FT                   \ SacI-KpnI-SmaI-ApaI-BsmI-NaeI-BsmI-XhoI-BamHI-XbaI
FT                   \ cgagctcggtacccgggcccgaatgccggcattctcgaggggatcctcta
FT                   \ gag
FT                   -> pZP19 2739bp [SmaI]"
FT   -               1..414
FT                   /note="pUC19 1..414 414bp
FT                   SmaI = XmaI = CCC^GGG
FT                   \                 cgagct..."
FT   -               415..467
FT                   /note="53bp
FT                   \ cgagctcggtacccgggcccgaatgccggcattctcgaggggatcctcta
FT                   \ gag
FT                   \      ...tctagag
FT                   SmaI = XmaI = CCC^GGG"
FT   -               468..2739
FT                   /note="pUC19 415..2686 2272bp"
FT   misc_binding    1..53
FT                   /note="MCS from pZP19"
FT   misc_binding    27..28
FT                   /note="SIT BsmI cleavage/insertion site"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 2739 BP; 675 A; 692 C; 704 G; 668 T; 0 other;
     tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
     accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc
     attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat
     tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt
     tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgagctcggt accccgagct
     cggtacccgg gcccgaatgc cggcattctc gaggggatcc tctagagggg gatcctctag
     agtcgacctg caggcatgca agcttggcgt aatcatggtc atagctgttt cctgtgtgaa
     attgttatcc gctcacaatt ccacacaaca tacgagccgg aagcataaag tgtaaagcct
     ggggtgccta atgagtgagc taactcacat taattgcgtt gcgctcactg cccgctttcc
     agtcgggaaa cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg
     gtttgcgtat tgggcgctct tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc
     ggctgcggcg agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag
     gggataacgc aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa
     aggccgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc
     gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc
     ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg
     cctttctccc ttcgggaagc gtggcgcttt ctcaatgctc acgctgtagg tatctcagtt
     cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc
     gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc
     cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag
     agttcttgaa gtggtggcct aactacggct acactagaag gacagtattt ggtatctgcg
     ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa
     ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag
     gatctcaaga agatcctttg atcttttcta cggggtctga cgctcagtgg aacgaaaact
     cacgttaagg gattttggtc atgagattat caaaaaggat cttcacctag atccttttaa
     attaaaaatg aagttttaaa tcaatctaaa gtatatatga gtaaacttgg tctgacagtt
     accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt tcatccatag
     ttgcctgact ccccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca
     gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca gcaataaacc
     agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt
     ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg
     ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg gcttcattca
     gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgtgc aaaaaagcgg
     ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg ttatcactca
     tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaga tgcttttctg
     tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct
     cttgcccggc gtcaatacgg gataataccg cgccacatag cagaacttta aaagtgctca
     tcattggaaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca
     gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg
     tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata agggcgacac
     ggaaatgttg aatactcata ctcttccttt ttcaatatta ttgaagcatt tatcagggtt
     attgtctcat gagcggatac atatttgaat gtatttagaa aaataaacaa ataggggttc
     cgcgcacatt tccccgaaaa gtgccacctg acgtctaaga aaccattatt atcatgacat
     taacctataa aaataggcgt atcacgaggc cctttcgtc
//