back Return to this vector's summary.
ID   RPSE937    preliminary; circular DNA; SYN; 7798 BP.
XX
AC   U02436;
XX
DT   03-FEB-1994 (Rel. 8, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli phagemid vector rpSE937 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-7798
RC   rpSE937
RA   Kitts P.A.;
RT   "CLONTECH Vectors On Disc version 1.1";
RL   Unpublished (1993).
XX
RN   [2]
RP   1-7798
RC   rpSE937
RA   Kitts P.A.;
RT   ;
RL   Submitted (07-OCT-1993) by:
RL   Kitts P.A., CLONTECH Laboratories, Inc.,
RL   4030 Fabian Way, Palo Alto, CA 94303, USA.
XX
RN   [3]
RP   1-7798
RC   [pSE345 from pSE series]
RC   pNN401 from lambda gt11 & pSE345
RC   [pNN454 from lambda]
RC   pSE251 from pUC19 & Tn5, neo gene
RC   pNN402 from pNN401 & pSE251 & pUC19
RC   plasmid from pNN402 & pBS39
RC   lambda KC from plasmid & lambda
RC   pSE936 from pUC19 & HIS3 & YIp5 & CEN4 & pNN454 & ARS1 & GAL10-1
RC   lambda YES-R from pSE936 & lambda gt6 & linker
RC   pSE937 from pSE936 & GAL1 gene
RC   lambda YES-P from pSE937 & lambda YES-R
RA   Elledge S.J., Mulligan J.T., Ramer S.W., Spottswood M., Davis R.W.;
RT   "LambdaYES: a multifunctional cDNA expression vector for the
RT   isolation of genes by complementation of yeast and Escherichia coli
RT   mutations";
RL   Proc. Natl. Acad. Sci. U.S.A. 88:1731-1735(1991).
XX
RN   [4]
RC   [lambda gt6 from lambda]
RC   lambda gt7 from lambda
RA   Davis R.W., Botstein D., Roth J.R.;
RT   ;
RL   Advanced Bacterial Genetics 0:0-0(1980).
RL   Cold Spring Harbor Laboratory, Cold Spring Harbor NY.
XX
RN   [5]
RC   pBMTx from mouse MT gene
RA   Pavlakis G.;
RT   ;
RL   Unpublished (1987).
XX
RN   [6]
RC   pRH499 from pRH43
RA   Hoess R.;
RT   ;
RL   Unpublished (1987).
XX
RN   [7]
RC   pCP-2-4-10 from yeast chromosome XIII ILV2 gene
RA   Falco S.C., Dumas K.S.;
RT   "Genetic analysis of mutants of Saccharomyces cerevisiae resistant
RT   to the herbicide sulfometuron methyl";
RL   Genetics 109:21-35(1985).
XX
RN   [8]
RC   pJM53 from yeast chromosome VII TRP5-LEU1 region
RA   Golin J.E., Falco S.C., Margolskee J.P.;
RT   "Coincident gene conversion events in yeast that involve a large
RT   insertion";
RL   Genetics 114:1081-1094(1987).
XX
CC   Lambda YES-P can be obtained from CLONTECH Laboratories, Inc., 4030
CC   Fabian Way, Palo Alto, CA 94303, USA. To place an order call (415)
CC   424-8222 or (800) 662-2566, extension 1. International customers,
CC   please contact your local distributor.  For technical information,
CC   call (415) 424- 8222 or (800) 662-2566, extension 3. This sequence
CC   has been compiled from information in the sequence databases,
CC   published literature and other sources, together with partial
CC   sequences obtained by CLONTECH; this vector has not been completely
CC   sequenced. If you suspect there is an error in this sequence,
CC   please contact CLONTECH's Technical Service Department at (415)
CC   424-8222 or (800) 662-2566, extension 3 or E-mail
CC   CLONTECH@BIOTECHNET.COM.
CC   NCBI gi: 413802
CC   NM (rpSE937)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (CLONTECH)
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (lambda)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. lambda
FT                   -> pNN454
FT                   1. oligo 12bp gcggccggccgc
FT                   2. yeast HindIII-XhoI 365bp, HIS3 gene terminator
FT                   \ pYAC4 368bp 5045..4677
FT                   3. YIp5 SalI-PvuII 2595bp 655..3250,URA3 gene [2682bp]
FT                   4. yeast PvuII-HpaI 852bp, CEN4
FT                   5. pNN454 SalI-XhoI 200bp, lox-NotI-lox
FT                   6. yeast NaeI-HindIII 454bp, ARS1
FT                   7. pBR322 PvuII-EcoRI 2291bp 2069..4360,
FT                   \ ori/amp gene [2295bp]
FT                   8. yeast EcoRI-EcoRI 822bp, GAL10-1 promoter
FT                   9. oligo EcoRI-XhoI-EcoRI-initi-cat 51bp
FT                   \ gaattcctcgaggaattcataattttttcctccagatcctctagagtccat
FT                   10. E. coli AluI-AluI 159bp, lac promoter
FT                   11. pUC19 HincII-HindIII 16bp 432..448, MCS [19bp]
FT                   -> pSE936 7908bp
FT                   1. pSE936 remove EcoRI-EcoRI 822bp, GAL10-1 promoter
FT                   2. yeast AvaI 907bp, 88..88 GAL1 promoter
FT                   EcoRI linker 6bp gaattc
FT                   EcoRI-EcoRI 907bp, GAL1 promoter
FT                   -> pSE937 7798bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 7798 BP; 2160 A; 1794 C; 1711 G; 2133 T; 0 other;
     gaattcctcg aggaattcat aattttttcc tccagatcct ctagagtcct gtttcctgtg
     tgaaattgtt atccgctcac aattccacac aacatacgag ccggaagcat aaagtgtaaa
     gcctggggtg cctaatgagt gagctaactc acattaattg cgttgcgctc actgcccgct
     ttccagtcgg gaaacctgtc gtgccaggac ctgcaggcat gcaagctgcg gccggccgca
     gctttgcaga ggctagcaga attaccctcc acgttgattg tctgcgaggc aagaatgatc
     atcaccgtag tgagagtgcg ttcaaggctc ttgcggttgc cataagagaa gccacctcgc
     ccaatggtac caacgatgtt ccctccacca aaggtgttct tatgtagtga caccgattat
     ttaaagctgc agcatacgat atatatacat gtgtatatat gtatacctat gaatgtcagt
     aagtatgtat acgaacagta tgatactgaa gatgacaagg taatgcatca ttctatacgt
     gtcattctga acgaggcgcg ctttcctttt ttctttttgc tttttctttt tttttctctt
     gaactcgacc gatgcccttg agagccttca acccagtcag ctccttccgg tgggcgcggg
     gcatgactat cgtcgccgca cttatgactg tcttctttat catgcaactc gtaggacagg
     tgccggcagc gctctgggtc attttcggcg aggaccgctt tcgctggagc gcgacgatga
     tcggcctgtc gcttgcggta ttcggaatct tgcacgccct cgctcaagcc ttcgtcactg
     gtcccgccac caaacgtttc ggcgagaagc aggccattat cgccggcatg gcggccgacg
     cgctgggcta cgtcttgctg gcgttcgcga cgcgaggctg gatggccttc cccattatga
     ttcttctcgc ttccggcggc atcgggatgc ccgcgttgca ggccatgctg tccaggcagg
     tagatgacga ccatcaggga cagcttcaag gatcgctcgc ggctcttacc agcctaactt
     cgatcactgg accgctgatc gtcacggcga tttatgccgc ctcggcgagc acatggaacg
     ggttggcatg gattgtaggc gccgccctat accttgtctg cctccccgcg ttgcgtcgcg
     gtgcatggag ccgggccacc tcgacctgaa tggaagccgg cggcacctcg ctaacggatt
     caccactcca agaattggag ccaatcaatt cttgcggaga actgtgaatg cgcaaaccaa
     cccttggcag aacatatcca tcgcgtccgc catctccagc agccgcacgc ggcgcatccc
     cccccccctt tcaattcaat tcatcatttt ttttttattc ttttttttga tttcggtttc
     tttgaaattt ttttgattcg gtaatctccg aacagaagga agaacgaagg aaggagcaca
     gacttagatt ggtatatata cgcatatgta gtgttgaaga aacatgaaat tgcccagtat
     tcttaaccca actgcacaga acaaaaacct gcaggaaacg aagataaatc atgtcgaaag
     ctacatataa ggaacgtgct gctactcatc ctagtcctgt tgctgccaag ctatttaata
     tcatgcacga aaagcaaaca aacttgtgtg cttcattgga tgttcgtacc accaaggaat
     tactggagtt agttgaagca ttaggtccca aaatttgttt actaaaaaca catgtggata
     tcttgactga tttttccatg gagggcacag ttaagccgct aaaggcatta tccgccaagt
     acaatttttt actcttcgaa gacagaaaat ttgctgacat tggtaataca gtcaaattgc
     agtactctgc gggtgtatac agaatagcag aatgggcaga cattacgaat gcacacggtg
     tggtgggccc aggtattgtt agcggtttga agcaggcggc agaagaagta acaaaggaac
     ctagaggcct tttgatgtta gcagaattgt catgcaaggg ctccctatct actggagaat
     atactaaggg tactgttgac attgcgaaga gcgacaaaga ttttgttatc ggctttattg
     ctcaaagaga catgggtgga agagatgaag gttacgattg gttgattatg acacccggtg
     tgggtttaga tgacaaggga gacgcattgg gtcaacagta tagaaccgtg gatgatgtgg
     tctctacagg atctgacatt attattgttg gaagaggact atttgcaaag ggaagggatg
     ctaaggtaga gggtgaacgt tacagaaaag caggctggga agcatatttg agaagatgcg
     gccagcaaaa ctaaaaaact gtattataag taaatgcatg tatactaaac tcacaaatta
     gagcttcaat ttaattatat cagttattac ccgggaatct cggtcgtaat gatttttata
     atgacgaaaa aaaaaaaatt ggaaagaaaa gggggggggg gcagcgttgg gtcctggcca
     cgggtgcgca tgatcgtgct cctgtcgttg aggacccggc taggctggcg gggttgcctt
     actggttagc agaatgaatc accgatacgc gagcgaacgt gaagcgactg ctgctgcaaa
     acgtctgcga cctgagcaac aacatgaatg gtcttcggtt tccgtgtttc gtaaagtctg
     gaaacgcgga agtcagcgcc ctgcaccatt atgttccgga tctgcatcgc aggatgctgc
     tggctaccct gtggaacacc tacatctgta ttaacgaagc gctggcattg accctgagtg
     atttttctct ggtcccgccg catccatacc gccagttgtt taccctcaca acgttccagt
     aaccgggcat gttcatcatc agtaacccgt atcgtgagca tcctctctcg tttcatcggt
     atcattaccc ccatgaacag aaatccccct tacacggagg catcagtgac caaacaggaa
     aaaaccgccc ttaacatggc ccgctttatc agaagccaga cattaacgct tctggagaaa
     ctcaacgagc tggacgcgga tgaacaggca gacatctgtg aatcgcttca cgaccacgct
     gatgagcttt accgcagctg ggccattctc atgaagaata tcttgaattt attgtcatat
     tactagttgg tgtggaagtc catatatcgg tgatcaatat agtggttgac atgctggcta
     gtcaacattg agccttttga tcatgcaaat atattacggt attttacaat caaatatcaa
     acttaactat tgactttata acttatttag gtggtaacat tcttataaaa aagaaaaaaa
     ttactgcaaa acagtactag cttttaactt gtatcctagg ttatctatgc tgtctcacca
     tagagaatat tacctatttc agaatgtatg tccatgattc gccgggtaaa tacatataat
     acacaaatct ggcttaataa agtctataat atatctcata aagaagtgct aaattggcta
     gtgctatata tttttaagaa aatttctttt gactaagtcc atatcgactt tgtaaaagtt
     cactttagca tacatatatt acacgagcca gaaattgtaa cttttgccta aaatcacaaa
     ttgcaaaatt taattgcttg caaaaggtca catgcttata atcaactttt ttaaaaattt
     aaaatacttt tttatttttt atttttaaac ataaatgaaa taatttattt attgtttatg
     attaccgaaa cataaaacct gctcaagaaa aagaaactgt tttgtccttg gaaaaaaagc
     actacctagg agcggccaaa atgccgaggc tttcatagct taaactcttt acagaaaata
     ggcattatag atcagttcga gttttcttat tcttccttcc ggttttatcg tcacagtttt
     acagtaaata agtatcacct cttagagttg cggccggtcg accaattccg atcatattca
     ataaccctta atataacttc gtataatgta tgctatacga agttattagg tccctcgacc
     ggccgcggcg gttgtttgca agaccgagaa aaggctagca agaatcgggt cattgtagcg
     tatgcgcctg tgaacattct cttcaacaag tttgattcca ttgcggtgaa atggtaaaag
     tcaaccccct gcgatgtata ttttcctgta caatcaatca aaaagccaaa tgatttagca
     ttatctttac atcttgttat tttacagatt ttatgtttag atcttttatg cttgcttttc
     aaaaggcctg caggcaagtg cacaaacaat acttaaataa atactactca gtaataacct
     atttcttagc atttttgacg aaatttgcta ttttgttaga gtcttttaca ccatttgtct
     ccacacctcc gcttacatca acaccaataa cgccatttaa tctaagcgca tcaccaacat
     tttctggcgt cagtccacca gctaacataa aatgttgcct cgcgcgtttc ggtgatgacg
     gtgaaaacct ctgacacatg cagctcccgg agacggtcac agcttgtctg taagcggatg
     ccgggagcag acaagcccgt cagggcgcgt cagcgggtgt tggcgggtgt cggggcgcag
     ccatgaccca gtcacgtagc gatagcggag tgtatactgg cttaactatg cggcatcaga
     gcagattgta ctgagagtgc accatatgcg gtgtgaaata ccgcacagat gcgtaaggag
     aaaataccgc atcaggcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt
     tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc
     aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa
     aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa
     tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc
     ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc
     cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta ggtatctcag
     ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga
     ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc
     gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac
     agagttcttg aagtggtggc ctaactacgg ctacactaga aggacagtat ttggtatctg
     cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca
     aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa
     aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa
     ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt
     aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag
     ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat
     agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc
     cagtgctgca atgataccgc gagacccacg ctcaccggct ccagatttat cagcaataaa
     ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca
     gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa
     cgttgttgcc attgctgcag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt
     cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc
     ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact
     catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc
     tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg
     ctcttgcccg gcgtcaacac gggataatac cgcgccacat agcagaactt taaaagtgct
     catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc
     cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta ctttcaccag
     cgtttctggg tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa taagggcgac
     acggaaatgt tgaatactca tactcttcct ttttcaatat tattgaagca tttatcaggg
     ttattgtctc atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt
     tccgcgcaca tttccccgaa aagtgccacc tgacgtctaa gaaaccatta ttatcatgac
     attaacctat aaaaataggc gtatcacgag gccctttcgt cttcaagaat taattcgaca
     ggttatcagc aacaacacag tcatatccat tctcaattag ctctaccaca gtgtgtgaac
     caatgtatcc agcaccacct gtaaccaaaa caattttaga agtactttca ctttgtaact
     gagctgtcat ttatattgaa ttttcaaaaa ttcttacttt ttttttggat ggacgcaaag
     aagtttaata atcatattac atggcattac caccatatac atatccatat acatatccat
     atctaatctt acttatatgt tgtggaaatg taaagagccc cattatctta gcctaaaaaa
     accttctctt tggaactttc agtaatacgc ttaactgctc attgctatat tgaagtacgg
     attagaagcc gccgagcggg tgacagccct ccgaaggaag actctcctcc gtgcgtcctc
     gtcttcaccg gtcgcgttcc tgaaacgcag atgtgcctcg cgccgcactg ctccgaacaa
     taaagattct acaatactag cttttatggt tatgaagagg aaaaattggc agtaacctgg
     ccccacaaac cttcaaatga acgaatcaaa ttaacaacca taggatgata atgcgattag
     ttttttagcc ttatttctgg ggtaattaat cagcgaagcg atgatttttg atctattaac
     agatatataa atgcaaaaac tgcataacca ctttaactaa tactttcaac attttcggtt
     tgtattactt cttattcaaa tgtaataaaa gtatcaacaa aaaattgtta atatacctct
     atactttaac gtcaaggaga aaaaactata atgactaaat ctcattcaga agaagtgatt
     gtacctgagt tcaattctag cgcaaaggaa ttaccaagac cattggccga aaagtgcg
//