back Return to this vector's summary.
ID   SSEV19     preliminary; circular DNA; SYN; 7299 BP.
XX
AC   IG5114;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector SSEV19 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   SSEV18 from M13mp18 & linker
RC   SSEV19 from M13mp19 & linker
RC   SSEV19/900 from SSEV19 & M13Mh129
RC   pUC18/900 from pUC18 & M13Mh129, M.hyorhinis 23S rRNA gene
RA   Biernat J., Gobel U.B., Koster H.;
RT   "New bacteriophage vectors for the large scale production of single
RT   stranded insert DNA";
RL   J. Biochem. Biophys. Methods 19:155-167(1989).
XX
RN   [2]
RC   M13Mh39, M13Mh129, M13Mh171 from M13mp8 & M.hyorhinis 23S rRNA gene
RA   Gobel U.B., Stanbridge E.J.;
RT   "Cloned mycoplasma ribosomal RNA genes for the detection of
RT   mycoplasma contamination in tissue cultures";
RL   Science 226:1211-1213(1984).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   MCS. oligonucleotide linker.
CC   NM (SSEV19)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (M13mp19)
CC   BR (SSEV18)
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. M13mp19 remove HindIII-EcoRI 51bp
FT                   \ 6235..6286, MCS/7199bp
FT                   2. linker HindIII-EcoRI 96bp
FT                   \ agctcccggagggaattccatcgaagcttgcatgcctgcaggtcgactct
FT                   \ agaggatccccgggtaccgagctctcgatggaattccctccggaga
FT                   -> SSEV19 7295bp"
FT   -               1..6238
FT                   /note="M13mp19 1..6238 6238bp
FT                   HindIII = A^AGCT T
FT                   \                agctcc..."
FT   -               6239..6334
FT                   /note="96bp
FT                   \ agctcccggagggaattccatcgaagcttgcatgcctgcaggtcgactct
FT                   \ agaggatccccgggtaccgagctctcgatggaattccctccggaga
FT                   \ ...cggaga
FT                   EcoRI =   G^AATTC"
FT   -               6335..7299
FT                   /note="M13mp19 6286..7250 965bp"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 7299 BP; 1780 A; 1554 C; 1544 G; 2421 T; 0 other;
     aatgctacta ctattagtag aattgatgcc accttttcag ctcgcgcccc aaatgaaaat
     atagctaaac aggttattga ccatttgcga aatgtatcta atggtcaaac taaatctact
     cgttcgcaga attgggaatc aactgttaca tggaatgaaa cttccagaca ccgtacttta
     gttgcatatt taaaacatgt tgagctacag caccagattc agcaattaag ctctaagcca
     tccgcaaaaa tgacctctta tcaaaaggag caattaaagg tactctctaa tcctgacctg
     ttggagtttg cttccggtct ggttcgcttt gaagctcgaa ttaaaacgcg atatttgaag
     tctttcgggc ttcctcttaa tctttttgat gcaatccgct ttgcttctga ctataatagt
     cagggtaaag acctgatttt tgatttatgg tcattctcgt tttctgaact gtttaaagca
     tttgaggggg attcaatgaa tatttatgac gattccgcag tattggacgc tatccagtct
     aaacatttta ctattacccc ctctggcaaa acttcttttg caaaagcctc tcgctatttt
     ggtttttatc gtcgtctggt aaacgagggt tatgatagtg ttgctcttac tatgcctcgt
     aattcctttt ggcgttatgt atctgcatta gttgaatgtg gtattcctaa atctcaactg
     atgaatcttt ctacctgtaa taatgttgtt ccgttagttc gttttattaa cgtagatttt
     tcttcccaac gtcctgactg gtataatgag ccagttctta aaatcgcata aggtaattca
     caatgattaa agttgaaatt aaaccatctc aagcccaatt tactactcgt tctggtgttt
     ctcgtcaggg caagccttat tcactgaatg agcagctttg ttacgttgat ttgggtaatg
     aatatccggt tcttgtcaag attactcttg atgaaggtca gccagcctat gcgcctggtc
     tgtacaccgt tcatctgtcc tctttcaaag ttggtcagtt cggttccctt atgattgacc
     gtctgcgcct cgttccggct aagtaacatg gagcaggtcg cggatttcga cacaatttat
     caggcgatga tacaaatctc cgttgtactt tgtttcgcgc ttggtataat cgctgggggt
     caaagatgag tgttttagtg tattctttcg cctctttcgt tttaggttgg tgccttcgta
     gtggcattac gtattttacc cgtttaatgg aaacttcctc atgaaaaagt ctttagtcct
     caaagcctct gtagccgttg ctaccctcgt tccgatgctg tctttcgctg ctgagggtga
     cgatcccgca aaagcggcct ttaactccct gcaagcctca gcgaccgaat atatcggtta
     tgcgtgggcg atggttgttg tcattgtcgg cgcaactatc ggtatcaagc tgtttaagaa
     attcacctcg aaagcaagct gataaaccga tacaattaaa ggctcctttt ggagcctttt
     tttttggaga ttttcaacgt gaaaaaatta ttattcgcaa ttcctttagt tgttcctttc
     tattctcact ccgctgaaac tgttgaaagt tgtttagcaa aaccccatac agaaaattca
     tttactaacg tctggaaaga cgacaaaact ttagatcgtt acgctaacta tgagggttgt
     ctgtggaatg ctacaggcgt tgtagtttgt actggtgacg aaactcagtg ttacggtaca
     tgggttccta ttgggcttgc tatccctgaa aatgagggtg gtggctctga gggtggcggt
     tctgagggtg gcggttctga gggtggcggt actaaacctc ctgagtacgg tgatacacct
     attccgggct atacttatat caaccctctc gacggcactt atccgcctgg tactgagcaa
     aaccccgcta atcctaatcc ttctcttgag gagtctcagc ctcttaatac tttcatgttt
     cagaataata ggttccgaaa taggcagggg gcattaactg tttatacggg cactgttact
     caaggcactg accccgttaa aacttattac cagtacactc ctgtatcatc aaaagccatg
     tatgacgctt actggaacgg taaattcaga gactgcgctt tccattctgg ctttaatgaa
     gatccattcg tttgtgaata tcaaggccaa tcgtctgacc tgcctcaacc tcctgtcaat
     gctggcggcg gctctggtgg tggttctggt ggcggctctg agggtggtgg ctctgagggt
     ggcggttctg agggtggcgg ctctgaggga ggcggttccg gtggtggctc tggttccggt
     gattttgatt atgaaaagat ggcaaacgct aataaggggg ctatgaccga aaatgccgat
     gaaaacgcgc tacagtctga cgctaaaggc aaacttgatt ctgtcgctac tgattacggt
     gctgctatcg atggtttcat tggtgacgtt tccggccttg ctaatggtaa tggtgctact
     ggtgattttg ctggctctaa ttcccaaatg gctcaagtcg gtgacggtga taattcacct
     ttaatgaata atttccgtca atatttacct tccctccctc aatcggttga atgtcgccct
     tttgtcttta gcgctggtaa accatatgaa ttttctattg attgtgacaa aataaactta
     ttccgtggtg tctttgcgtt tcttttatat gttgccacct ttatgtatgt attttctacg
     tttgctaaca tactgcgtaa taaggagtct taatcatgcc agttcttttg ggtattccgt
     tattattgcg tttcctcggt ttccttctgg taactttgtt cggctatctg cttacttttc
     ttaaaaaggg cttcggtaag atagctattg ctatttcatt gtttcttgct cttattattg
     ggcttaactc aattcttgtg ggttatctct ctgatattag cgctcaatta ccctctgact
     ttgttcaggg tgttcagtta attctcccgt ctaatgcgct tccctgtttt tatgttattc
     tctctgtaaa ggctgctatt ttcatttttg acgttaaaca aaaaatcgtt tcttatttgg
     attgggataa ataatatggc tgtttatttt gtaactggca aattaggctc tggaaagacg
     ctcgttagcg ttggtaagat tcaggataaa attgtagctg ggtgcaaaat agcaactaat
     cttgatttaa ggcttcaaaa cctcccgcaa gtcgggaggt tcgctaaaac gcctcgcgtt
     cttagaatac cggataagcc ttctatatct gatttgcttg ctattgggcg cggtaatgat
     tcctacgatg aaaataaaaa cggcttgctt gttctcgatg agtgcggtac ttggtttaat
     acccgttctt ggaatgataa ggaaagacag ccgattattg attggtttct acatgctcgt
     aaattaggat gggatattat ttttcttgtt caggacttat ctattgttga taaacaggcg
     cgttctgcat tagctgaaca tgttgtttat tgtcgtcgtc tggacagaat tactttacct
     tttgtcggta ctttatattc tcttattact ggctcgaaaa tgcctctgcc taaattacat
     gttggcgttg ttaaatatgg cgattctcaa ttaagcccta ctgttgagcg ttggctttat
     actggtaaga atttgtataa cgcatatgat actaaacagg ctttttctag taattatgat
     tccggtgttt attcttattt aacgccttat ttatcacacg gtcggtattt caaaccatta
     aatttaggtc agaagatgaa attaactaaa atatatttga aaaagttttc tcgcgttctt
     tgtcttgcga ttggatttgc atcagcattt acatatagtt atataaccca acctaagccg
     gaggttaaaa aggtagtctc tcagacctat gattttgata aattcactat tgactcttct
     cagcgtctta atctaagcta tcgctatgtt ttcaaggatt ctaagggaaa attaattaat
     agcgacgatt tacagaagca aggttattca ctcacatata ttgatttatg tactgtttcc
     attaaaaaag gtaattcaaa tgaaattgtt aaatgtaatt aattttgttt tcttgatgtt
     tgtttcatca tcttcttttg ctcaggtaat tgaaatgaat aattcgcctc tgcgcgattt
     tgtaacttgg tattcaaagc aatcaggcga atccgttatt gtttctcccg atgtaaaagg
     tactgttact gtatattcat ctgacgttaa acctgaaaat ctacgcaatt tctttatttc
     tgttttacgt gctaataatt ttgatatggt tggttcaatt ccttccataa ttcagaagta
     taatccaaac aatcaggatt atattgatga attgccatca tctgataatc aggaatatga
     tgataattcc gctccttctg gtggtttctt tgttccgcaa aatgataatg ttactcaaac
     ttttaaaatt aataacgttc gggcaaagga tttaatacga gttgtcgaat tgtttgtaaa
     gtctaatact tctaaatcct caaatgtatt atctattgac ggctctaatc tattagttgt
     tagtgcacct aaagatattt tagataacct tcctcaattc ctttctactg ttgatttgcc
     aactgaccag atattgattg agggtttgat atttgaggtt cagcaaggtg atgctttaga
     tttttcattt gctgctggct ctcagcgtgg cactgttgca ggcggtgtta atactgaccg
     cctcacctct gttttatctt ctgctggtgg ttcgttcggt atttttaatg gcgatgtttt
     agggctatca gttcgcgcat taaagactaa tagccattca aaaatattgt ctgtgccacg
     tattcttacg ctttcaggtc agaagggttc tatctctgtt ggccagaatg tcccttttat
     tactggtcgt gtgactggtg aatctgccaa tgtaaataat ccatttcaga cgattgagcg
     tcaaaatgta ggtatttcca tgagcgtttt tcctgttgca atggctggcg gtaatattgt
     tctggatatt accagcaagg ccgatagttt gagttcttct actcaggcaa gtgatgttat
     tactaatcaa agaagtattg ctacaacggt taatttgcgt gatggacaga ctcttttact
     cggtggcctc actgattata aaaacacttc tcaagattct ggcgtaccgt tcctgtctaa
     aatcccttta atcggcctcc tgtttagctc ccgctctgat tccaacgagg aaagcacgtt
     atacgtgctc gtcaaagcaa ccatagtacg cgccctgtag cggcgcatta agcgcggcgg
     gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag cgccctagcg cccgctcctt
     tcgctttctt cccttccttt ctcgccacgt tcgccggctt tccccgtcaa gctctaaatc
     gggggctccc tttagggttc cgatttagtg ctttacggca cctcgacccc aaaaaacttg
     atttgggtga tggttcacgt agtgggccat cgccctgata gacggttttt cgccctttga
     cgttggagtc cacgttcttt aatagtggac tcttgttcca aactggaaca acactcaacc
     ctatctcggg ctattctttt gatttataag ggattttgcc gatttcggaa ccaccatcaa
     acaggatttt cgcctgctgg ggcaaaccag cgtggaccgc ttgctgcaac tctctcaggg
     ccaggcggtg aagggcaatc agctgttgcc cgtctcgctg gtgaaaagaa aaaccaccct
     ggcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc
     acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc
     tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa
     ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac gccaagctag
     ctcccggagg gaattccatc gaagcttgca tgcctgcagg tcgactctag aggatccccg
     ggtaccgagc tctcgatgga attccctccg gagaaattca ctggccgtcg ttttacaacg
     tcgtgactgg gaaaaccctg gcgttaccca acttaatcgc cttgcagcac atcccccttt
     cgccagctgg cgtaatagcg aagaggcccg caccgatcgc ccttcccaac agttgcgcag
     cctgaatggc gaatggcgct ttgcctggtt tccggcacca gaagcggtgc cggaaagctg
     gctggagtgc gatcttcctg aggccgatac ggtcgtcgtc ccctcaaact ggcagatgca
     cggttacgat gcgcccatct acaccaacgt aacctatccc attacggtca atccgccgtt
     tgttcccacg gagaatccga cgggttgtta ctcgctcaca tttaatgttg atgaaagctg
     gctacaggaa ggccagacgc gaattatttt tgatggcgtt cctattggtt aaaaaatgag
     ctgatttaac aaaaatttaa cgcgaatttt aacaaaatat taacgtttac aatttaaata
     tttgcttata caatcttcct gtttttgggg cttttctgat tatcaaccgg ggtacatatg
     attgacatgc tagttttacg attaccgttc atcgattctc ttgtttgctc cagactctca
     ggcaatgacc tgatagcctt tgtagatctc tcaaaaatag ctaccctctc cggcattaat
     ttatcagcta gaacggttga atatcatatt gatggtgatt tgactgtctc cggcctttct
     cacccttttg aatctttacc tacacattac tcaggcattg catttaaaat atatgagggt
     tctaaaaatt tttatccttg cgttgaaata aaggcttctc ccgcaaaagt attacagggt
     cataatgttt ttggtacaac cgatttagct ttatgctctg aggctttatt gcttaatttt
     gctaattctt tgccttgcct gtatgattta ttggatgtt
//