back Return to this vector's summary.
ID   SVPOLY     preliminary; circular DNA; SYN; 3195 BP.
XX
AC   IG5165;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector SVpoly - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pLJ from SV40 early promoter
RC   SVpoly from pPolyIII & pSVL & pLJ, SV40 early promoter
RA   Stacey A., Schnieke A.;
RT   "SVpoly: a versatile mammalian expression vector";
RL   Nucleic Acids Res. 18:2829-2829(1990).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   MCS. not original sequence.
CC   NM (SVpoly)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pPolyIII-I)(pSVL)(pBR322)(SV40)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. SV40, early promoter/SV40 #V01380 5243bp
FT                   -> pLJ
FT                   1. pPolyIII-I BglII-XhoI 2004bp 133..2117..20, ori/amp
FT                   2. pLJ PvuII-HindIII 344bp, SV40 early promoter
FT                   \ SV40 5172..5243..273
FT                   \ HindIII = 1047 1494 1709 3477 4003 5172
FT                   \ PvuII = 273 1719 3509
FT                   3. pPolyIII-I HindIII-BamHI 51bp 30..80
FT                   \ aagcttcttctagaggtaccgcatgcgatatcgagctctcccgggaat
FT                   \ tcggatcc, MCS
FT                   \ [HindIII-XbaI-KpnI-EcoRV-SstI-SmaI-EcoRI-BamHI]
FT                   4. pSVL BamHI-SalI 517bp 1531..2048, SV40 late polyA
FT                   5. pBR322 BamHI-SalI 276bp 376..652, tet
FT                   -> SVpoly 2956bp"
FT   -               1..2008
FT                   /note="pPolyIII-I 133..2117..23 2008bp
FT                   XhoI = C^TCGA G
FT                   PvuII =   CAG^CTG"
FT   -               2009..2352
FT                   /note="SV40 5172..5243..272 344bp
FT                   HindIII = A^AGCTT"
FT   -               2353..2402
FT                   /note="50bp
FT                   \ agcttcttctagaggtaccgcatgcgatatcgagctctcccgggaattcg
FT                   BamHI = G^GATCC"
FT   -               2403..2919
FT                   /note="pSVL 1531..2047 517bp
FT                   SalI = G^TCGAC"
FT   -               2920..3195
FT                   /note="pBR322 380..655 276bp complement
FT                   BamHI = G^GATCC
FT                   BglII = A^GATCT"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 3195 BP; 766 A; 825 C; 826 G; 778 T; 0 other;
     gatctgcgac gcgaggctgg atggccttcc ccattatgat tcttctcgct tccggcggca
     tcgggatgcc cgcgttgcag gccatgctgt ccaggcaggt agatgacgac catcagggac
     agcttcacgg ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc
     ataggctccg cccccctgac gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa
     acccgacagg actataaaga taccaggcgt ttccccctgg aagctccctc gtgcgctctc
     ctgttccgac cctgccgctt accggatacc tgtccgcctt tctcccttcg ggaagcgtgg
     cgctttctca atgctcacgc tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc
     tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc ggtaactatc
     gtcttgagtc caacccggta agacacgact tatcgccact ggcagcagcc actggtaaca
     ggattagcag agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg tggcctaact
     acggctacac tagaaggaca gtatttggta tctgcgctct gctgaagcca gttaccttcg
     gaaaaagagt tggtagctct tgatccggca aacaaaccac cgctggtagc ggtggttttt
     ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat cctttgatct
     tttctacggg gtctgacgct cagtggaacg aaaactcacg ttaagggatt ttggtcatga
     gattatcaaa aaggatcttc acctagatcc ttttaaatca atctaaagta tatatgagta
     aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct
     atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg
     cttaccatct ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga
     tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt
     atccgcctcc atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt
     taatagtttg cgcaacgttg ttgccattgt gcaggcatcg tggtgtcacg ctcgtcgttt
     ggtatggctt cattcagctc cggttcccaa cgatcaaggc gagttacatg atcccccatg
     ttgtgcaaaa aagcggttag ctccttcggt cctccgatcg ttgtcagaag taagttggcc
     gcagtgttat cactcatggt tatggcagca ctgcataatt ctcttactgt catgccatcc
     gtaagatgct tttctgtgac tggtgagtac tcaaccaagt cattctgaga atagtgtatg
     cggcgaccga gttgctcttg cccggcgtca acacgggata ataccgcgcc acatagcaga
     actttaaaag tgctcatcat tggaaaacgt tcttcggggc gaaaactctc aaggatctta
     ccgctgttga gatccagttc gatgtaaccc actcgtgcac ccaactgatc ttcagcatct
     tttactttca ccagcgtttc tgggtgagca aaaacaggaa ggcaaaatgc cgcaaaaaag
     ggaataaggg cgacacggaa atgttgaata ctcatactct tcctttttca atattattga
     agcatttatc agggttattg tctcatgagc ggatacatat ttgaatgtat ttagaaaaat
     aaacaaatag gggttccgcg cacatttccc cgaaaagtgc cacctgacgt ctaagaaacc
     attattatca tgacattaac ctataaaaat aggcgtatca cgaggccctt tcgtcttcaa
     gaattggatc tgcggccgcc ggcctcgaag ctttttgcaa aagcctaggc ctccaaaaaa
     gcctcctcac tacttctgga atagctcaga ggccgaggcg gcctcggcct ctgcataaat
     aaaaaaaatt agtcagccat ggggcggaga atgggcggaa ctgggcggag ttaggggcgg
     gatgggcgga gttaggggcg ggactatggt tgctgactaa ttgagatgca tgctttgcat
     acttctgcct gctggggagc ctggggactt tccacacctg gttgctgact aattgagatg
     catgctttgc atacttctgc ctgctgggga gcctggggac tttccacacc ctaactgaca
     cacattccac agagcttctt ctagaggtac cgcatgcgat atcgagctct cccgggaatt
     cggatccaga catgataaga tacattgatg agtttggaca aaccacaact agaatgcagt
     gaaaaaaatg ctttatttgt gaaatttgtg atgctattgc tttatttgta accattataa
     gctgcaataa acaagttaac aacaacaatt gcattcattt tatgtttcag gttcaggggg
     aggtgtggga ggttttttaa agcaagtaaa acctctacaa atgtggtatg gctgattatg
     atcgatcctc tacgccggac gcatcgtggc cggcatcacc ggcgccacag gtgcggttgc
     tggcgcctat atcgccgaca tcaccgatgg ggaagatcgg gctcgccact tcgggctcat
     gagcgcttgt ttcggcgtgg gtatggtggc aggccccgtg gccgggggac tgttgggcgc
     catctccttg catgcaccat tccttgcggc ggcggtgctc aacggcctca acctactact
     gggctgcttc ctaatgcagg agtcgcataa gggagagcgt cgacgctctc ccttatgcga
     ctcctgcatt aggaagcagc ccagtagtag gttgaggccg ttgagcaccg ccgccgcaag
     gaatggtgca tgcaaggaga tggcgcccaa cagtcccccg gccacggggc ctgccaccat
     acccacgccg aaacaagcgc tcatgagccc gaagtggcga gcccgatctt ccccatcggt
     gatgtcggcg atataggcgc cagcaaccgc acctgtggcg ccggtgatgc cggccacgat
     gcgtccggcg tagag
//