back Return to this vector's summary.
ID   YCPGAL1    preliminary; circular DNA; SYN; 6781 BP.
XX
AC   IG5061;
XX
DT   01-OCT-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector YCpGAL1 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   YCpGAL0 from YCplac111 & pBM272
RC   YCpGAL1, YCpGAL2, YCpGAL3 from YCpGAL0 & oligo
RC   pCRF1, pCRF2, pCRF3 from HSV-1 VP16 gene
RC   pDBD series from YCpGAL1 & pCRF1
RA   Bonner J.J.;
RT   "Vectors for the expression and analysis of DNA-binding proteins in
RT   yeast";
RL   Gene 104:113-118(1991).
XX
RN   [2]
RC   pMSVP16 from MSV LTR & HSV-1 VP16 gene
RC   pICP4tk from HSV-1 ICP4 gene/tk gene
RA   Triezenberg S.J., Kingsbury R.C., McKnight S.L.;
RT   "Functional dissection of VP16, the trans-activator of herpes
RT   simplex virus immediate early gene expression";
RL   Genes Dev. 2:718-729(1988).
XX
RN   [3]
RC   pMSVtk from MSV LTR & HSV-1 tk gene
RA   Graves B.J., Eisenman R.N., McKnight S.L.;
RT   "Delineation of transcriptional control signals within the Moloney
RT   murine sarcoma virus long terminal repeat";
RL   Mol. Cell. Biol. 5:1948-1958(1985).
XX
RN   [4]
RC   pMSVcat from MSV LTR & cat gene
RA   Triezenberg S.J., LaMarco K.L., McKnight S.L.;
RT   "Evidence of DNA:protein interactions that mediate HSV-1 immediate
RT   early geen activation by VP16";
RL   Genes Dev. 2:730-742(1988).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   MCS. oligonucleotide linker.
CC   NM (YCpGAL1)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (pBM272)(YCplac111)
CC   BR (YCpGAL2)(YCpGAL3)
CC   OF (pDBD)
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. YCplac111 BglII 6112bp 1987..1987
FT                   Klenow
FT                   EcoRI-BamHI 6091bp 285..6112..264,
FT                   \ lacZ/CEN4/ARS1/LEU2/amp
FT                   2. pBM272 EcoRI-BamHI 678bp 2..680, GAL1-GAL10 regulat
FT                   -> plasmid 6779bp
FT                   1. plasmid EcoRI 6779bp 285..285
FT                   Klenow
FT                   -> YCpGAL0 6781bp
FT                   1. YCpGAL0 BamHI-HindIII 6749bp
FT                   \ 264..-..285..6112..234
FT                   blunt end:blunt end
FT                   2. oligo 38bp
FT                   \ agctaataatgtctaagcttcccggggaattcagatct
FT                   -> YCpGAL1 6781bp"
FT   -               1..1706
FT                   /note="YCplac111 285..1990 1706bp
FT                   BglII = A^GATC T
FT                   BglII =      A^GATCT"
FT   -               1707..6065
FT                   /note="YCplac111 1987..6112..233 4359bp
FT                   HindIII = A^AGCTT
FT                   \           agcta..."
FT   -               6066..6103
FT                   /note="agctaataatgtctaagcttcccggggaattcagatct 38bp
FT                   \    ...agatct
FT                   BamHI = G^GATC C"
FT   -               6104..6781
FT                   /note="pBM272 2..679 678bp complement
FT                   EcoRI = G^AATT C
FT                   EcoRI =      G^AATTC"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
XX
SQ   Sequence 6781 BP; 1967 A; 1413 C; 1424 G; 1977 T; 0 other;
     aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa accctggcgt tacccaactt
     aatcgccttg cagcacatcc ccctttcgcc agctggcgta atagcgaaga ggcccgcacc
     gatcgccctt cccaacagtt gcgcagcctg aatggcgaat ggcgcctgat gcggtatttt
     ctccttacgc atctgtgcgg tatttcacac cgcatatatc gctgggccat tctcatgaag
     aatatcttga atttattgtc atattactag ttggtgtgga agtccatata tcggtgatca
     atatagtggt tgacatgctg gctagtcaac attgagcctt ttgatcatgc aaatatatta
     cggtatttta caatcaaata tcaaacttaa ctattgactt tataacttat ttaggtggta
     acattcttat aaaaaagaaa aaaattactg caaaacagta ctagctttta acttgtatcc
     taggttatct atgctgtctc accatagaga atattaccta tttcagaatg tatgtccatg
     attcgccggg taaatacata taatacacaa atctggctta ataaagtcta taatatatct
     cataaagaag tgctaaattg gctagtgcta tatattttta agaaaatttc ttttgactaa
     gtccatatcg actttgtaaa agttcacttt agcatacata tattacacga gccagaaatt
     gtaacttttg cctaaaatca caaattgcaa aatttaattg cttgcaaaag gtcacatgct
     tataatcaac ttttttaaaa atttaaaata cttttttatt ttttattttt aaacataaat
     gaaataattt atttattgtt tatgattacc gaaacataaa acctgctcaa gaaaaagaaa
     ctgttttgtc cttggaaaaa aagcactacc taggagcggc caaaatgccg aggctttcat
     agcttaaact ctttacagaa aataggcatt atagatcagt tcgagttttc ttattcttcc
     ttccggtttt atcgtcacag ttttacagta aataagtatc acctcttaga gttcgatgat
     aagctgtcaa acatgagaat taattccaca tgttaaaata gtgaaggagc atgttcggca
     cacagtggac cgaacgtggg gtaagtgcac tagggtccgg ttaaacggat ctcgcattga
     tgaggcaacg ctaattatca acatatagat tgttatctat ctgcatgaac acgaaatctt
     tacttgacga cttgaggctg atggtgttta tgcaaagaaa ccactgtgtt taatatgtgt
     cactgtttga tattactgtc agcgtagaag ataatagtaa aagcggttaa taagtgtatt
     tgagataagt gtgataaagt ttttacagcg aaaagacgat aaatacaaga aaatgattac
     gaggatacgg agagaggtat gtacatgtgt atttatatac taagctgccg gcggttgttt
     gcaagaccga gaaaaggcta gcaagaatcg ggtcattgta gcgtatgcgc ctgtgaacat
     tctcttcaac aagtttgatt ccattgcggt gaaatggtaa aagtcaaccc cctgcgatgt
     atattttcct gtacaatcaa tcaaaaagcc aaatgattta gcattatctt tacatcttgt
     tattttacag attttatgtt tagatcgatc ttttatgctt gcttttcaaa aggcttgcag
     gcaagtgcac aaacaatact taaataaata ctactcagta ataacctatt tcttagcatt
     tttgacgaaa tttgctattt tgttagagtc ttttacacca tttgtctcca cacctccgct
     tacatcaaca ccaataacgc catttaatct aagcgcatca ccaacatttt ctggcgtcag
     tccaccagct aacataaaat gtaagctctc ggggctctct tgccttccaa cccagtcaga
     aatcgagttc caatccaaaa gttcacctgt cccacctgct tctgaatcaa acaagggaat
     aaacgaatga ggtttctgtg aagctgcact gagtagtatg ttgcagtctt ttggaaatac
     gagtctttta ataactggca aaccgaggaa ctcttggtat tcttgccacg actcatctcc
     atgcagttgg acgatcgatg ataagctgtc aaacatgaga attaattcta ccctatgaac
     atattccatt ttgtaatttc gtgtcgtttc tattatgaat ttcatttata aagtttatgt
     acaaatatca taaaaaaaga gaatcttttt aagcaaggat tttcttaact tcttcggcga
     cagcatcacc gacttcggtg gtactgttgg aaccacctaa atcaccagtt ctgatacctg
     catccaaaac ctttttaact gcatcttcaa tggccttacc ttcttcaggc aagttcaatg
     acaatttcaa catcattgca gcagacaaga tagtggcgat agggtcaacc ttattctttg
     gcaaatctgg agcagaaccg tggcatggtt cgtacaaacc aaatgcggtg ttcttgtctg
     gcaaagaggc caaggacgca gatggcaaca aacccaagga acctgggata acggaggctt
     catcggagat gatatcacca aacatgttgc tggtgattat aataccattt aggtgggttg
     ggttcttaac taggatcatg gcggcagaat caatcaattg atgttgaacc ttcaatgtag
     gaaattcgtt cttgatggtt tcctccacag tttttctcca taatcttgaa gaggccaaaa
     cattagcttt atccaaggac caaataggca atggtggctc atgttgtagg gccatgaaag
     cggccattct tgtgattctt tgcacttctg gaacggtgta ttgttcacta tcccaagcga
     caccatcacc atcgtcttcc tttctcttac caaagtaaat acctcccact aattctctga
     caacaacgaa gtcagtacct ttagcaaatt gtggcttgat tggagataag tctaaaagag
     agtcggatgc aaagttacat ggtcttaagt tggcgtacaa ttgaagttct ttacggattt
     ttagtaaacc ttgttcaggt ctaacactac ctgtacccca tttaggacca cccacagcac
     ctaacaaaac ggcatcaacc ttcttggagg cttccagcgc ctcatctgga agtgggacac
     ctgtagcatc gatagcagca ccaccaatta aatgattttc gaaatcgaac ttgacattgg
     aacgaacatc agaaatagct ttaagaacct taatggcttc ggctgtgatt tcttgaccaa
     cgtggtcacc tggcaaaacg acgatcttct taggggcaga cataggggca gacattagaa
     tggtatatcc ttgaaatata tatatatatt gctgaaatgt aaaaggtaag aaaagttaga
     aagtaagacg attgctaacc acctattgga aaaaacaata ggtccttaaa taatattgtc
     aacttcaagt attgtgatgc aagcatttag tcatgaacgc ttctctattc tatatgaaaa
     gccggttccg gcctctcacc tttccttttt ctcccaattt ttcagttgaa aaaggtatat
     gcgtcaggcg acctctgaaa ttaacaaaaa atttccagtc atcgaatttg attctgtgcg
     atagcgcccc tgtgtgttct cgttatgttg aggaaaaaaa taatggttgc taagagattc
     gaactcttgc atcttacgat acctgagtat tcccacagtt aattcttgaa gacgaaaggg
     cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt cttagacgtc
     aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca
     ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa
     aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt
     ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca
     gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag
     ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc
     ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca
     gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt
     aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct
     gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt
     aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga
     caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact
     tactctagct tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc
     acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga
     gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt
     agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga
     gataggtgcc tcactgatta agcattggta actgtcagac caagtttact catatatact
     ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga
     taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt
     agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca
     aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct
     ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc ttctagtgta
     gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct
     aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc
     aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca
     gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg agctatgaga
     aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg
     aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt
     cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag
     cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt
     tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt
     tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga
     ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta
     atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca acgcaattaa
     tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc cggctcgtat
     gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg accatgatta
     cgccaagcta ataatgtcta agcttcccgg ggaattcaga tctcggggtt ttttctcctt
     gacgttaaag tatagaggta tattaacaat tttttgttga tacttttatt acatttgaat
     aagaagtaat acaaaccgaa aatgttgaaa gtattagtta aagtggttat gcagtttttg
     catttatata tctgttaata gatcaaaaat catcgcttcg ctgattaatt accccagaaa
     taaggctaaa aaactaatcg cattatcatc ctatggttgt taatttgatt cgttcatttg
     aaggtttgtg gggccaggtt actgccaatt tttcctcttc ataaccataa aagctagtat
     tgtagaatct ttattgttcg gagcagtgcg gcgcgaggca catctgcgtt tcaggaacgc
     gaccggtgaa gacgaggacg cacggaggag agtcttcctt cggagggctg tcacccgctc
     ggcggcttct aatccgtact tcaatatagc aatgagcagt taagcgtatt actgaaagtt
     ccaaagagaa ggttttttta ggctaagata atggggctct ttacatttcc acaacatata
     agtaagatta gatatggata tgtatatgga tatgtatatg gtggtaatgc catgtaatat
     gattattaaa cttctttgcg tccatccaaa aaaaaagtaa gaatttttga aaattcgaat
     t
//