back Return to this vector's summary.
ID   YEP356     preliminary; circular DNA; SYN; 7965 BP.
XX
AC   ATCC37731;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli plasmid vector YEp356 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   YEp352E from YEp352 & linker
RC   YEp363A from pNM480 & YEp351
RC   YEp353A from pNM480 & YEp352
RC   YEp353 from YEp353A & YEp352E
RC   YEp354A from pNM481 & YEp352
RC   YEp354 from YEp354A & YEp352E
RC   YEp355A from pNM482 & YEp352
RC   YEp355 from YEp355A & YEp352E
RC   YEp356, YEp356R from YEp353 & pUC18
RC   YEp357, YEp357R from YEp354 & pUC18
RC   YEp358, YEp358R from YEp355 & pUC18
RC   YEp363 from YEp363A & YEp353
RC   YEp364 from YEp363A & YEp354
RC   YEp365 from YEp363A & YEp355
RC   YEp366 from YEp363A & YEp356
RC   YEp367 from YEp363A & YEp357
RC   YEp368 from YEp363A & YEp358
RC   YEp366R from YEp363A & YEp356R
RC   YEp367R from YEp363A & YEp357R
RC   YEp368R from YEp363A & YEp358R
RC   YIp353 from YEp353 & YIp352
RC   YIp354 from YEp354 & YIp352
RC   YIp355 from YEp355 & YIp352
RC   YIp356 from YEp356 & YIp352
RC   YIp357 from YEp357 & YIp352
RC   YIp358 from YEp358 & YIp352
RC   YIp356R from YEp356R & YIp352
RC   YIp357R from YEp357R & YIp352
RC   YIp358R from YEp358R & YIp352
RC   YIp363 from YEp363 & YIp351
RC   YIp364 from YEp364 & YIp351
RC   YIp365 from YEp365 & YIp351
RC   YIp366 from YEp366 & YIp351
RC   YIp367 from YEp367 & YIp351
RC   YIp368 from YEp368 & YIp351
RC   YIp366R from YEp366R & YIp351
RC   YIp367R from YEp367R & YIp351
RC   YIp368R from YEp368R & YIp351
RA   Myers A.M., Tzagoloff A., Kinney D.M., Lusty C.J.;
RT   "Yeast shuttle and integrative vectors with multiple cloning sites
RT   suitable for construction of lacZ fusions";
RL   Gene 45:299-310(1986).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   The sequence and reading frame of the multiple cloning sequence is:
CC   5' GA ATT CGA GCT CGG TAC CCG GGG ATC CTC TAG AGT CGA CCT GCA GGC ATG
CC   CAA GCT TGC GAT CCC 3', from nucleotide 1 of MCS through CCC for amino
CC   acid 8 of beta-galactosidase.
CC   One of 3 promoter-cloning, YE type shuttle vectors (ATCC 37731 to
CC   ATCC 37733) with URA3 selection in Saccharomyces cerevisiae, a
CC   beta-galactosidase reporter gene and multiple cloning sites differing
CC   in reading frame.
CC   The cleavage position in the reading frame for cloning sites is (where
CC   3 = between triplets): EcoRI-2; SacI-3; KpnI-3; SmaI-2; BamHI-2;
CC   XbaI-2; SalI-2; PstI-3; SphI-3; HindIII-2. The SacI site is not
CC   unique.
CC   Cloning into the EcoRI, SacI, KpnI SmaI, BamHI, or XbaI sites leads to
CC   a TAG stop codon within the downstream XbaI site of the multiple
CC   cloning region.
CC   Restriction digests of the clone give the following sizes (kb):
CC   PstI--8.0; HindIII--8.0; SalI--8.0; EcoRI--8.0; BamHI--8.0. (ATCC
CC   staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (YEp356)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli HB101)(Saccharomyces cerevisiae)(E.coli)(E.coli MC1061)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (YEp353)(pUC18)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. YEp353 remove EcoRI-HindIII 30bp 2..32, MCS
FT                   \ 7914bp
FT                   2. pUC18 HindIII-EcoRI 51bp 400..451, MCS
FT                   -> YEp356 7965bp"
FT   -               1..1
FT                   /note="YEp353 1..1 1bp
FT                   EcoRI = G^AATTC
FT                   \         aattc..."
FT   -               2..52
FT                   /note="51bp
FT                   \ aattcgagctcggtacccggggatcctctagagtcgacctgcaggcatgca
FT                   \  ...atgca
FT                   HindIII = A^AGCTT"
FT   -               53..7965
FT                   /note="YEp353 32..7944 7913bp"
FT   misc_binding    0..0
FT                   /note="MCS EcoRI-SacI-KpnI-SmaI-BamHI-XbaI-SalI-
FT                   PstI-SphI-HindIII"
FT   misc_binding    0..0
FT                   /note="SIT unique EcoRI-KpnI-SmaI-BamHI-XbaI-SalI-
FT                   PstI-SphI-HindIII"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   rep_origin      0..0
FT                   /note="ORI yeast 2 micron"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ);
FT                   reporter gene"
FT   CDS             0..0
FT                   /note="ANT yeast URA3 gene"
XX
SQ   Sequence 7965 BP; 1986 A; 1959 C; 1942 G; 2078 T; 0 other;
     gaattcgagc tcggtacccg gggatcctct agagtcgacc tgcaggcatg caagcttgcg
     atcccgccgt cgttttacaa cgtcgtgact gggaaaaccc tggcgttacc caacttaatc
     gccttgcagc acatccccct ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc
     gcccttccca acagttgcgc agcctgaatg gcgaatggcg ctttgcctgg tttccggcac
     cagaagcggt gccggaaagc tggctggagt gcgatcttcc tgaggccgat actgtcgtcg
     tcccctcaaa ctggcagatg cacggttacg atgcgcccat ctacaccaac gtaacctatc
     ccattacggt caatccgccg tttgttccca cggagaatcc gacgggttgt tactcgctca
     catttaatgt tgatgaaagc tggctacagg aaggccagac gcgaattatt tttgatggcg
     ttaactcggc gtttcatctg tggtgcaacg ggcgctgggt cggttacggc caggacagtc
     gtttgccgtc tgaatttgac ctgagcgcat ttttacgcgc cggagaaaac cgcctcgcgg
     tgatggtgct gcgttggagt gacggcagtt atctggaaga tcaggatatg tggcggatga
     gcggcatttt ccgtgacgtc tcgttgctgc ataaaccgac tacacaaatc agcgatttcc
     atgttgccac tcgctttaat gatgatttca gccgcgctgt actggaggct gaagttcaga
     tgtgcggcga gttgcgtgac tacctacggg taacagtttc tttatggcag ggtgaaacgc
     aggtcgccag cggcaccgcg cctttcggcg gtgaaattat cgatgagcgt ggtggttatg
     ccgatcgcgt cacactacgt ctgaacgtcg aaaacccgaa actgtggagc gccgaaatcc
     cgaatctcta tcgtgcggtg gttgaactgc acaccgccga cggcacgctg attgaagcag
     aagcctgcga tgtcggtttc cgcgaggtgc ggattgaaaa tggtctgctg ctgctgaacg
     gcaagccgtt gctgattcga ggcgttaacc gtcacgagca tcatcctctg catggtcagg
     tcatggatga gcagacgatg gtgcaggata tcctgctgat gaagcagaac aactttaacg
     ccgtgcgctg ttcgcattat ccgaaccatc cgctgtggta cacgctgtgc gaccgctacg
     gcctgtatgt ggtggatgaa gccaatattg aaacccacgg catggtgcca atgaatcgtc
     tgaccgatga tccgcgctgg ctaccggcga tgagcgaacg cgtaacgcga atggtgcagc
     gcgatcgtaa tcacccgagt gtgatcatct ggtcgctggg gaatgaatca ggccacggcg
     ctaatcacga cgcgctgtat cgctggatca aatctgtcga tccttcccgc ccggtgcagt
     atgaaggcgg cggagccgac accacggcca ccgatattat ttgcccgatg tacgcgcgcg
     tggatgaaga ccagcccttc ccggctgtgc cgaaatggtc catcaaaaaa tggctttcgc
     tacctggaga gacgcgcccg ctgatccttt gcgaatacgc ccacgcgatg ggtaacagtc
     ttggcggttt cgctaaatac tggcaggcgt ttcgtcagta tccccgttta cagggcggct
     tcgtctggga ctgggtggat cagtcgctga ttaaatatga tgaaaacggc aacccgtggt
     cggcttacgg cggtgatttt ggcgatacgc cgaacgatcg ccagttctgt atgaacggtc
     tggtctttgc cgaccgcacg ccgcatccag cgctgacgga agcaaaacac cagcagcagt
     ttttccagtt ccgtttatcc gggcaaacca tcgaagtgac cagcgaatac ctgttccgtc
     atagcgataa cgagctcctg cactggatgg tggcgctgga tggtaagccg ctggcaagcg
     gtgaagtgcc tctggatgtc gctccacaag gtaaacagtt gattgaactg cctgaactac
     cgcagccgga gagcgccggg caactctggc tcacagtacg cgtagtgcaa ccgaacgcga
     ccgcatggtc agaagccggg cacatcagcg cctggcagca gtggcgtctg gcggaaaacc
     tcagtgtgac gctccccgcc gcgtcccacg ccatcccgca tctgaccacc agcgaaatgg
     atttttgcat cgagctgggt aataagcgtt ggcaatttaa ccgccagtca ggctttcttt
     cacagatgtg gattggcgat aaaaaacaac tgctgacgcc gctgcgcgat cagttcaccc
     gtgcaccgct ggataacgac attggcgtaa gtgaagcgac ccgcattgac cctaacgcct
     gggtcgaacg ctggaaggcg gcgggccatt accaggccga agcagcgttg ttgcagtgca
     cggcagatac acttgctgat gcggtgctga ttacgaccgc tcacgcgtgg cagcatcagg
     ggaaaacctt atttatcagc cggaaaacct accggattga tggtagtggt caaatggcga
     ttaccgttga tgttgaagtg gcgagcgata caccgcatcc ggcgcggatt ggcctgaact
     gccagctggc gcaggtagca gagcgggtaa actggctcgg attagggccg caagaaaact
     atcccgaccg ccttactgcc gcctgttttg accgctggga tctgccattg tcagacatgt
     ataccccgta cgtcttcccg agcgaaaacg gtctgcgctg cgggacgcgc gaattgaatt
     atggcccaca ccagtggcgc ggcgacttcc agttcaacat cagccgctac agtcaacagc
     aactgatgga aaccagccat cgccatctgc tgcacgcgga agaaggcaca tggctgaata
     tcgacggttt ccatatgggg attggtggcg acgactcctg gagcccgtca gtatcggcgg
     aattccagct gagcgccggt cgctaccatt accagttggt ctggtgtcaa aaataataat
     aaccgggcag gccatgtctg cccgtatttc gcgtaaggaa atccattatg tactatttcg
     cctgatgcgg tattttctcc ttacgcatct gtgcggtatt tcacaccgca tagggtaata
     actgatataa ttaaattgaa gctctaattt gtgagtttag tatacatgca tttacttata
     atacagtttt ttagttttgc tggccgcatc ttctcaaata tgcttcccag cctgcttttc
     tgtaacgttc accctctacc ttagcatccc ttccctttgc aaatagtcct cttccaacaa
     taataatgtc agatcctgta gagaccacat catccacggt tctatactgt tgacccaatg
     cgtctccctt gtcatctaaa cccacaccgg gtgtcataat caaccaatcg taaccttcat
     ctcttccacc catgtctctt tgagcaataa agccgataac aaaatctttg tcgctcttcg
     caatgtcaac agtaccctta gtatattctc cagtagatag ggagcccttg catgacaatt
     ctgctaacat caaaaggcct ctaggttcct ttgttacttc ttctgccgcc tgcttcaaac
     cgctaacaat acctgggccc accacaccgt gtgcattcgt aatgtctgcc cattctgcta
     ttctgtatac acccgcagag tactgcaatt tgactgtatt accaatgtca gcaaattttc
     tgtcttcgaa gagtaaaaaa ttgtacttgg cggataatgc ctttagcggc ttaactgtgc
     cctccatgga aaaatcagtc aagatatcca catgtgtttt tagtaaacaa attttgggac
     ctaatgcttc aactaactcc agtaattcct tggtggtacg aacatccaat gaagcacaca
     agtttgtttg cttttcgtgc atgatattaa atagcttggc agcaacagga ctaggatgag
     tagcagcacg ttccttatat gtagctttcg acatgattta tcttcgtttt ttgttctgtg
     cagttgggtt aagaatactg ggcaatttca tgtttcttca acactacata tgcgtatata
     taccaatcta agtctgtgct ccttccttcg ttcttccttc tgttcggaga ttaccgaatc
     aaaaaaattt caaagaaacc gaaatcaaaa aaaagaataa aaaaaaaatg atgaattgaa
     ttgaaaagct acttgttacc catcattgaa ttttgaacat ccgaacctgg gagttttccc
     tgaaacagat agtatatttg aacctgtata ataatatata gtctagcgct ttacggaaga
     caatgtatgt atttcggttc ctggagaaac tattgcatct attgcatagg taatcttgca
     cgtcgcatcc ccggttcatt ttctgcgttt ccatcttgca cttcaatagc atatctttgt
     taacgaagca tctgtgcttc attttgtaga acaaaaatgc aacgcgagag cgctaatttt
     tcaaacaaag aatctgagct gcatttttac agaacagaaa tgcaacgcga aagcgctatt
     ttaccaacga agaatctgtg cttcattttt gtaaaacaaa aatgcaacgc gagagcgcta
     atttttcaaa caaagaatct gagctgcatt tttacagaac agaaatgcaa cgcgagagcg
     ctattttacc aacaaagaat ctatacttct tttttgttct acaaaaatgc atcccgagag
     cgctattttt ctaacaaagc atcttagatt actttttttc tcctttgtgc gctctataat
     gcagtctctt gataactttt tgcactgtag gtccgttaag gttagaagaa ggctactttg
     gtgtctattt tctcttccat aaaaaaagcc tgactccact tcccgcgttt actgattact
     agcgaagctg cgggtgcatt ttttcaagat aaaggcatcc ccgattatat tctataccga
     tgtggattgc gcatactttg tgaacagaaa gtgatagcgt tgatgattct tcattggtca
     gaaaattatg aacggtttct tctattttgt ctctatatac tacgtatagg aaatgtttac
     attttcgtat tgttttcgat tcactctatg aatagttctt actacaattt ttttgtctaa
     agagtaatac tagagataaa cataaaaaat gtagaggtcg agtttagatg caagttcaag
     gagcgaaagg tggatgggta ggttatatag ggatatagca cagagatata tagcaaagag
     atacttttga gcaatgtttg tggaagcggt attcgcaata ttttagtagc tcgttacagt
     ccggtgcgtt tttggttttt tgaaagtgcg tcttcagagc gcttttggtt ttcaaaagcg
     ctctgaagtt cctatacttt ctagctagag aataggaact tcggaatagg aacttcaaag
     cgtttccgaa aacgagcgct tccgaaaatg caacgcgagc tgcgcacata cagctcactg
     ttcacgtcgc acctatatct gcgtgttgcc tgtatatata tatacatgag aagaacggca
     tagtgcgtgt ttatgcttaa atgcgttatg gtgcactctc agtacaatct gctctgatgc
     cgcatagtta agccagcccc gacacccgcc aacacccgct gacgcgccct gacgggcttg
     tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct gcatgtgtca
     gaggttttca ccgtcatcac cgaaacgcgc gagacgaaag ggcctcgtga tacgcctatt
     tttataggtt aatgtcatga taataatggt ttcttagacg tcaggtggca cttttcgggg
     aaatgtgcgc ggaaccccta tttgtttatt tttctaaata cattcaaata tgtatccgct
     catgagacaa taaccctgat aaatgcttca ataatattga aaaaggaaga gtatgagtat
     tcaacatttc cgtgtcgccc ttattccctt ttttgcggca ttttgccttc ctgtttttgc
     tcacccagaa acgctggtga aagtaaaaga tgctgaagat cagttgggtg cacgagtggg
     ttacatcgaa ctggatctca acagcggtaa gatccttgag agttttcgcc ccgaagaacg
     ttttccaatg atgagcactt ttaaagttct gctatgtggc gcggtattat cccgtattga
     cgccgggcaa gagcaactcg gtcgccgcat acactattct cagaatgact tggttgagta
     ctcaccagtc acagaaaagc atcttacgga tggcatgaca gtaagagaat tatgcagtgc
     tgccataacc atgagtgata acactgcggc caacttactt ctgacaacga tcggaggacc
     gaaggagcta accgcttttt tgcacaacat gggggatcat gtaactcgcc ttgatcgttg
     ggaaccggag ctgaatgaag ccataccaaa cgacgagcgt gacaccacga tgcctgtagc
     aatggcaaca acgttgcgca aactattaac tggcgaacta cttactctag cttcccggca
     acaattaata gactggatgg aggcggataa agttgcagga ccacttctgc gctcggccct
     tccggctggc tggtttattg ctgataaatc tggagccggt gagcgtgggt ctcgcggtat
     cattgcagca ctggggccag atggtaagcc ctcccgtatc gtagttatct acacgacggg
     gagtcaggca actatggatg aacgaaatag acagatcgct gagataggtg cctcactgat
     taagcattgg taactgtcag accaagttta ctcatatata ctttagattg atttaaaact
     tcatttttaa tttaaaagga tctaggtgaa gatccttttt gataatctca tgaccaaaat
     cccttaacgt gagttttcgt tccactgagc gtcagacccc gtagaaaaga tcaaaggatc
     ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa aaccaccgct
     accagcggtg gtttgtttgc cggatcaaga gctaccaact ctttttccga aggtaactgg
     cttcagcaga gcgcagatac caaatactgt ccttctagtg tagccgtagt taggccacca
     cttcaagaac tctgtagcac cgcctacata cctcgctctg ctaatcctgt taccagtggc
     tgctgccagt ggcgataagt cgtgtcttac cgggttggac tcaagacgat agttaccgga
     taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca cagcccagct tggagcgaac
     gacctacacc gaactgagat acctacagcg tgagcattga gaaagcgcca cgcttcccga
     agggagaaag gcggacaggt atccggtaag cggcagggtc ggaacaggag agcgcacgag
     ggagcttcca gggggaaacg cctggtatct ttatagtcct gtcgggtttc gccacctctg
     acttgagcgt cgatttttgt gatgctcgtc aggggggcgg agcctatgga aaaacgccag
     caacgcggcc tttttacggt tcctggcctt ttgctggcct tttgctcaca tgttctttcc
     tgcgttatcc cctgattctg tggataaccg tattaccgcc tttgagtgag ctgataccgc
     tcgccgcagc cgaacgaccg agcgcagcga gtcagtgagc gaggaagcgg aagagcgccc
     aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat tcccg
//