back Return to this vector's summary.
ID   YEP356R    preliminary; circular DNA; SYN; 7983 BP.
XX
AC   ATCC37737;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli plasmid vector YEp356R - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   YEp352E from YEp352 & linker
RC   YEp363A from pNM480 & YEp351
RC   YEp353A from pNM480 & YEp352
RC   YEp353 from YEp353A & YEp352E
RC   YEp354A from pNM481 & YEp352
RC   YEp354 from YEp354A & YEp352E
RC   YEp355A from pNM482 & YEp352
RC   YEp355 from YEp355A & YEp352E
RC   YEp356, YEp356R from YEp353 & pUC18
RC   YEp357, YEp357R from YEp354 & pUC18
RC   YEp358, YEp358R from YEp355 & pUC18
RC   YEp363 from YEp363A & YEp353
RC   YEp364 from YEp363A & YEp354
RC   YEp365 from YEp363A & YEp355
RC   YEp366 from YEp363A & YEp356
RC   YEp367 from YEp363A & YEp357
RC   YEp368 from YEp363A & YEp358
RC   YEp366R from YEp363A & YEp356R
RC   YEp367R from YEp363A & YEp357R
RC   YEp368R from YEp363A & YEp358R
RC   YIp353 from YEp353 & YIp352
RC   YIp354 from YEp354 & YIp352
RC   YIp355 from YEp355 & YIp352
RC   YIp356 from YEp356 & YIp352
RC   YIp357 from YEp357 & YIp352
RC   YIp358 from YEp358 & YIp352
RC   YIp356R from YEp356R & YIp352
RC   YIp357R from YEp357R & YIp352
RC   YIp358R from YEp358R & YIp352
RC   YIp363 from YEp363 & YIp351
RC   YIp364 from YEp364 & YIp351
RC   YIp365 from YEp365 & YIp351
RC   YIp366 from YEp366 & YIp351
RC   YIp367 from YEp367 & YIp351
RC   YIp368 from YEp368 & YIp351
RC   YIp366R from YEp366R & YIp351
RC   YIp367R from YEp367R & YIp351
RC   YIp368R from YEp368R & YIp351
RA   Myers A.M., Tzagoloff A., Kinney D.M., Lusty C.J.;
RT   "Yeast shuttle and integrative vectors with multiple cloning sites
RT   suitable for construction of lacZ fusions";
RL   Gene 45:299-310(1986).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   The sequence and reading frame of the multiple cloning sequence is:
CC   5' AAG CTT GCA TGC CTG CAG GTC GAC TCT AGA GGA TCC CCG GGT ACC GAG CTC
CC   GAA TTC CCA GCT TGC GAT CCC 3', from nucleotide 1 of MCS through CCC
CC   for amino acid 8 of beta-galactosidase.
CC   One of 3 promoter-cloning, YE type shuttle vectors (ATCC 37737 to
CC   ATCC 37739) with URA3 selection in Saccharomyces cerevisiae, a
CC   beta-galactosidase reporter gene and multiple cloning sites differing
CC   in reading frame.
CC   The cleavage position in the reading frame for cloning sites is (where
CC   3 = between triplets): HindIII-1; SphI-2; PstI-2; SalI-1; XbaI-1;
CC   BamHI-1; SmaI-2; KpnI-2; SacI-2; EcoRI-1. The SacI site is not unique.
CC   Restriction digests of the clone give the following sizes (kb):
CC   HindIII--8.0; EcoRI--8.0; BamHI--8.0; PstI--8.0; SalI--8.0. (ATCC
CC   staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (YEp356R)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli HB101)(Saccharomyces cerevisiae)(E.coli)(E.coli MC1061)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (YEp353)(pUC18)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. YEp353 remove EcoRI-HindIII 30bp 2..32, MCS
FT                   \ 7914bp
FT                   Klenow:Klenow
FT                   2. pUC18 HindIII-EcoRI 51bp 400..451, MCS
FT                   HpaII methylase [to protect SmaI]
FT                   EcoRI-SmaI linker 11bp gaattcccggg:HindIII-SmaI linker
FT                   \ 13bp aagcttcccggga
FT                   SmaI-SmaI, MCS
FT                   -> YEp356R 7983bp"
FT   -               1..5
FT                   /note="YEp353 1..5 5bp
FT                   EcoRI = G^AATT C
FT                   \              gggaatt..."
FT   -               6..70
FT                   /note="65bp
FT                   \ gggaattcgagctcggtacccggggatcctctagagtcgacctgcaggca
FT                   \ gcatgcaagcttccc
FT                   \ ...cttccc
FT                   HindIII = A^AGCTT"
FT   -               71..7983
FT                   /note="YEp353 32..7944 7913bp"
FT   misc_binding    0..0
FT                   /note="MCS HindIII-SphI-PstI-SalI-XbaI-BamHI-SmaI-
FT                   KpnI-SacI-EcoRI"
FT   misc_binding    0..0
FT                   /note="SIT unique HindIII-SphI-PstI-SalI-XbaI-BamHI-
FT                   SmaI-KpnI-EcoRI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   rep_origin      0..0
FT                   /note="ORI yeast 2 micron"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ);
FT                   reporter gene"
FT   CDS             0..0
FT                   /note="ANT yeast URA3 gene"
XX
SQ   Sequence 7983 BP; 1990 A; 1964 C; 1947 G; 2082 T; 0 other;
     gaattgggaa ttcgagctcg gtacccgggg atcctctaga gtcgacctgc aggcagcatg
     caagcttccc agcttgcgat cccgccgtcg ttttacaacg tcgtgactgg gaaaaccctg
     gcgttaccca acttaatcgc cttgcagcac atcccccttt cgccagctgg cgtaatagcg
     aagaggcccg caccgatcgc ccttcccaac agttgcgcag cctgaatggc gaatggcgct
     ttgcctggtt tccggcacca gaagcggtgc cggaaagctg gctggagtgc gatcttcctg
     aggccgatac tgtcgtcgtc ccctcaaact ggcagatgca cggttacgat gcgcccatct
     acaccaacgt aacctatccc attacggtca atccgccgtt tgttcccacg gagaatccga
     cgggttgtta ctcgctcaca tttaatgttg atgaaagctg gctacaggaa ggccagacgc
     gaattatttt tgatggcgtt aactcggcgt ttcatctgtg gtgcaacggg cgctgggtcg
     gttacggcca ggacagtcgt ttgccgtctg aatttgacct gagcgcattt ttacgcgccg
     gagaaaaccg cctcgcggtg atggtgctgc gttggagtga cggcagttat ctggaagatc
     aggatatgtg gcggatgagc ggcattttcc gtgacgtctc gttgctgcat aaaccgacta
     cacaaatcag cgatttccat gttgccactc gctttaatga tgatttcagc cgcgctgtac
     tggaggctga agttcagatg tgcggcgagt tgcgtgacta cctacgggta acagtttctt
     tatggcaggg tgaaacgcag gtcgccagcg gcaccgcgcc tttcggcggt gaaattatcg
     atgagcgtgg tggttatgcc gatcgcgtca cactacgtct gaacgtcgaa aacccgaaac
     tgtggagcgc cgaaatcccg aatctctatc gtgcggtggt tgaactgcac accgccgacg
     gcacgctgat tgaagcagaa gcctgcgatg tcggtttccg cgaggtgcgg attgaaaatg
     gtctgctgct gctgaacggc aagccgttgc tgattcgagg cgttaaccgt cacgagcatc
     atcctctgca tggtcaggtc atggatgagc agacgatggt gcaggatatc ctgctgatga
     agcagaacaa ctttaacgcc gtgcgctgtt cgcattatcc gaaccatccg ctgtggtaca
     cgctgtgcga ccgctacggc ctgtatgtgg tggatgaagc caatattgaa acccacggca
     tggtgccaat gaatcgtctg accgatgatc cgcgctggct accggcgatg agcgaacgcg
     taacgcgaat ggtgcagcgc gatcgtaatc acccgagtgt gatcatctgg tcgctgggga
     atgaatcagg ccacggcgct aatcacgacg cgctgtatcg ctggatcaaa tctgtcgatc
     cttcccgccc ggtgcagtat gaaggcggcg gagccgacac cacggccacc gatattattt
     gcccgatgta cgcgcgcgtg gatgaagacc agcccttccc ggctgtgccg aaatggtcca
     tcaaaaaatg gctttcgcta cctggagaga cgcgcccgct gatcctttgc gaatacgccc
     acgcgatggg taacagtctt ggcggtttcg ctaaatactg gcaggcgttt cgtcagtatc
     cccgtttaca gggcggcttc gtctgggact gggtggatca gtcgctgatt aaatatgatg
     aaaacggcaa cccgtggtcg gcttacggcg gtgattttgg cgatacgccg aacgatcgcc
     agttctgtat gaacggtctg gtctttgccg accgcacgcc gcatccagcg ctgacggaag
     caaaacacca gcagcagttt ttccagttcc gtttatccgg gcaaaccatc gaagtgacca
     gcgaatacct gttccgtcat agcgataacg agctcctgca ctggatggtg gcgctggatg
     gtaagccgct ggcaagcggt gaagtgcctc tggatgtcgc tccacaaggt aaacagttga
     ttgaactgcc tgaactaccg cagccggaga gcgccgggca actctggctc acagtacgcg
     tagtgcaacc gaacgcgacc gcatggtcag aagccgggca catcagcgcc tggcagcagt
     ggcgtctggc ggaaaacctc agtgtgacgc tccccgccgc gtcccacgcc atcccgcatc
     tgaccaccag cgaaatggat ttttgcatcg agctgggtaa taagcgttgg caatttaacc
     gccagtcagg ctttctttca cagatgtgga ttggcgataa aaaacaactg ctgacgccgc
     tgcgcgatca gttcacccgt gcaccgctgg ataacgacat tggcgtaagt gaagcgaccc
     gcattgaccc taacgcctgg gtcgaacgct ggaaggcggc gggccattac caggccgaag
     cagcgttgtt gcagtgcacg gcagatacac ttgctgatgc ggtgctgatt acgaccgctc
     acgcgtggca gcatcagggg aaaaccttat ttatcagccg gaaaacctac cggattgatg
     gtagtggtca aatggcgatt accgttgatg ttgaagtggc gagcgataca ccgcatccgg
     cgcggattgg cctgaactgc cagctggcgc aggtagcaga gcgggtaaac tggctcggat
     tagggccgca agaaaactat cccgaccgcc ttactgccgc ctgttttgac cgctgggatc
     tgccattgtc agacatgtat accccgtacg tcttcccgag cgaaaacggt ctgcgctgcg
     ggacgcgcga attgaattat ggcccacacc agtggcgcgg cgacttccag ttcaacatca
     gccgctacag tcaacagcaa ctgatggaaa ccagccatcg ccatctgctg cacgcggaag
     aaggcacatg gctgaatatc gacggtttcc atatggggat tggtggcgac gactcctgga
     gcccgtcagt atcggcggaa ttccagctga gcgccggtcg ctaccattac cagttggtct
     ggtgtcaaaa ataataataa ccgggcaggc catgtctgcc cgtatttcgc gtaaggaaat
     ccattatgta ctatttcgcc tgatgcggta ttttctcctt acgcatctgt gcggtatttc
     acaccgcata gggtaataac tgatataatt aaattgaagc tctaatttgt gagtttagta
     tacatgcatt tacttataat acagtttttt agttttgctg gccgcatctt ctcaaatatg
     cttcccagcc tgcttttctg taacgttcac cctctacctt agcatccctt ccctttgcaa
     atagtcctct tccaacaata ataatgtcag atcctgtaga gaccacatca tccacggttc
     tatactgttg acccaatgcg tctcccttgt catctaaacc cacaccgggt gtcataatca
     accaatcgta accttcatct cttccaccca tgtctctttg agcaataaag ccgataacaa
     aatctttgtc gctcttcgca atgtcaacag tacccttagt atattctcca gtagataggg
     agcccttgca tgacaattct gctaacatca aaaggcctct aggttccttt gttacttctt
     ctgccgcctg cttcaaaccg ctaacaatac ctgggcccac cacaccgtgt gcattcgtaa
     tgtctgccca ttctgctatt ctgtatacac ccgcagagta ctgcaatttg actgtattac
     caatgtcagc aaattttctg tcttcgaaga gtaaaaaatt gtacttggcg gataatgcct
     ttagcggctt aactgtgccc tccatggaaa aatcagtcaa gatatccaca tgtgttttta
     gtaaacaaat tttgggacct aatgcttcaa ctaactccag taattccttg gtggtacgaa
     catccaatga agcacacaag tttgtttgct tttcgtgcat gatattaaat agcttggcag
     caacaggact aggatgagta gcagcacgtt ccttatatgt agctttcgac atgatttatc
     ttcgtttttt gttctgtgca gttgggttaa gaatactggg caatttcatg tttcttcaac
     actacatatg cgtatatata ccaatctaag tctgtgctcc ttccttcgtt cttccttctg
     ttcggagatt accgaatcaa aaaaatttca aagaaaccga aatcaaaaaa aagaataaaa
     aaaaaatgat gaattgaatt gaaaagctac ttgttaccca tcattgaatt ttgaacatcc
     gaacctggga gttttccctg aaacagatag tatatttgaa cctgtataat aatatatagt
     ctagcgcttt acggaagaca atgtatgtat ttcggttcct ggagaaacta ttgcatctat
     tgcataggta atcttgcacg tcgcatcccc ggttcatttt ctgcgtttcc atcttgcact
     tcaatagcat atctttgtta acgaagcatc tgtgcttcat tttgtagaac aaaaatgcaa
     cgcgagagcg ctaatttttc aaacaaagaa tctgagctgc atttttacag aacagaaatg
     caacgcgaaa gcgctatttt accaacgaag aatctgtgct tcatttttgt aaaacaaaaa
     tgcaacgcga gagcgctaat ttttcaaaca aagaatctga gctgcatttt tacagaacag
     aaatgcaacg cgagagcgct attttaccaa caaagaatct atacttcttt tttgttctac
     aaaaatgcat cccgagagcg ctatttttct aacaaagcat cttagattac tttttttctc
     ctttgtgcgc tctataatgc agtctcttga taactttttg cactgtaggt ccgttaaggt
     tagaagaagg ctactttggt gtctattttc tcttccataa aaaaagcctg actccacttc
     ccgcgtttac tgattactag cgaagctgcg ggtgcatttt ttcaagataa aggcatcccc
     gattatattc tataccgatg tggattgcgc atactttgtg aacagaaagt gatagcgttg
     atgattcttc attggtcaga aaattatgaa cggtttcttc tattttgtct ctatatacta
     cgtataggaa atgtttacat tttcgtattg ttttcgattc actctatgaa tagttcttac
     tacaattttt ttgtctaaag agtaatacta gagataaaca taaaaaatgt agaggtcgag
     tttagatgca agttcaagga gcgaaaggtg gatgggtagg ttatataggg atatagcaca
     gagatatata gcaaagagat acttttgagc aatgtttgtg gaagcggtat tcgcaatatt
     ttagtagctc gttacagtcc ggtgcgtttt tggttttttg aaagtgcgtc ttcagagcgc
     ttttggtttt caaaagcgct ctgaagttcc tatactttct agctagagaa taggaacttc
     ggaataggaa cttcaaagcg tttccgaaaa cgagcgcttc cgaaaatgca acgcgagctg
     cgcacataca gctcactgtt cacgtcgcac ctatatctgc gtgttgcctg tatatatata
     tacatgagaa gaacggcata gtgcgtgttt atgcttaaat gcgttatggt gcactctcag
     tacaatctgc tctgatgccg catagttaag ccagccccga cacccgccaa cacccgctga
     cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc
     cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga gacgaaaggg
     cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt cttagacgtc
     aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca
     ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa
     aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt
     ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca
     gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag
     ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc
     ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca
     gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt
     aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct
     gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt
     aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga
     caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact
     tactctagct tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc
     acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga
     gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt
     agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga
     gataggtgcc tcactgatta agcattggta actgtcagac caagtttact catatatact
     ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga
     taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt
     agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca
     aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct
     ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc ttctagtgta
     gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct
     aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc
     aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca
     gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg agcattgaga
     aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg
     aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt
     cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag
     cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt
     tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt
     tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga
     ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcattc
     ccg
//