back Return to this vector's summary.
ID   YEP357     preliminary; circular DNA; SYN; 7963 BP.
XX
AC   ATCC37732;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli plasmid vector YEp357 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   YEp352E from YEp352 & linker
RC   YEp363A from pNM480 & YEp351
RC   YEp353A from pNM480 & YEp352
RC   YEp353 from YEp353A & YEp352E
RC   YEp354A from pNM481 & YEp352
RC   YEp354 from YEp354A & YEp352E
RC   YEp355A from pNM482 & YEp352
RC   YEp355 from YEp355A & YEp352E
RC   YEp356, YEp356R from YEp353 & pUC18
RC   YEp357, YEp357R from YEp354 & pUC18
RC   YEp358, YEp358R from YEp355 & pUC18
RC   YEp363 from YEp363A & YEp353
RC   YEp364 from YEp363A & YEp354
RC   YEp365 from YEp363A & YEp355
RC   YEp366 from YEp363A & YEp356
RC   YEp367 from YEp363A & YEp357
RC   YEp368 from YEp363A & YEp358
RC   YEp366R from YEp363A & YEp356R
RC   YEp367R from YEp363A & YEp357R
RC   YEp368R from YEp363A & YEp358R
RC   YIp353 from YEp353 & YIp352
RC   YIp354 from YEp354 & YIp352
RC   YIp355 from YEp355 & YIp352
RC   YIp356 from YEp356 & YIp352
RC   YIp357 from YEp357 & YIp352
RC   YIp358 from YEp358 & YIp352
RC   YIp356R from YEp356R & YIp352
RC   YIp357R from YEp357R & YIp352
RC   YIp358R from YEp358R & YIp352
RC   YIp363 from YEp363 & YIp351
RC   YIp364 from YEp364 & YIp351
RC   YIp365 from YEp365 & YIp351
RC   YIp366 from YEp366 & YIp351
RC   YIp367 from YEp367 & YIp351
RC   YIp368 from YEp368 & YIp351
RC   YIp366R from YEp366R & YIp351
RC   YIp367R from YEp367R & YIp351
RC   YIp368R from YEp368R & YIp351
RA   Myers A.M., Tzagoloff A., Kinney D.M., Lusty C.J.;
RT   "Yeast shuttle and integrative vectors with multiple cloning sites
RT   suitable for construction of lacZ fusions";
RL   Gene 45:299-310(1986).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   Restriction digests of the clone give the following sizes (kb):
CC   EcoRI--8.0; BamHI--8.0; SalI--8.0; PstI--8.0. (ATCC staff)
CC   The sequence and reading frame of the multiple cloning sequence is:
CC   5' GAA TTC GAG CTC GGT ACC CGG GGA TCC TCT AGA GTC GAC CTG CAG GCA TGC
CC   AAG CTT GCT CCC 3', from nucleotide 1 of MCS through CCC for amino
CC   acid 8 of beta-galactosidase.
CC   One of 3 promoter-cloning, YE type shuttle vectors (ATCC 37731 to
CC   ATCC 37733) with URA3 selection in Saccharomyces cerevisiae, a
CC   beta-galactosidase reporter gene and multiple cloning sites differing
CC   in reading frame.
CC   The cleavage position in the reading frame for cloning sites is (where
CC   3 = between triplets): EcoRI-1; SacI-2; KpnI-2; SmaI-1; BamHI-1;
CC   XbaI-1; SalI-1; PstI-2; SphI-2; HindIII-1. The SacI site is not
CC   unique.
CC   Medium is 1227 LB plus ampicillin.
CC   NM (YEp357)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli HB101)(Saccharomyces cerevisiae)(E.coli)(E.coli MC1061)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (YEp354)(pUC18)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. YEp354 remove EcoRI-HindIII 30bp 2..32, MCS
FT                   \ 7914bp
FT                   2. pUC18 HindIII-EcoRI 51bp 400..451, MCS
FT                   -> YEp357 7965bp"
FT   -               1..1
FT                   /note="YEp353 1..1 1bp
FT                   EcoRI = G^AATTC
FT                   \         aattc..."
FT   -               2..52
FT                   /note="51bp
FT                   \ aattcgagctcggtacccggggatcctctagagtcgacctgcaggcatgca
FT                   \  ...atgca
FT                   HindIII = A^AGCTT"
FT   -               53..59
FT                   /note="YEp353 32..38 7bp"
FT   -               60..7963
FT                   /note="YEp353 41..7944 7904bp"
FT   misc_binding    0..0
FT                   /note="MCS EcoRI-SacI-KpnI-SmaI-BamHI-XbaI-SalI-
FT                   PstI-SphI-HindIII"
FT   misc_binding    0..0
FT                   /note="SIT unique EcoRI-KpnI-SmaI-BamHI-XbaI-SalI-
FT                   PstI-SphI-HindIII"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   rep_origin      0..0
FT                   /note="ORI yeast 2 micron"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ);
FT                   reporter gene"
FT   CDS             0..0
FT                   /note="ANT yeast URA3 gene"
XX
SQ   Sequence 7963 BP; 1985 A; 1959 C; 1941 G; 2078 T; 0 other;
     gaattcgagc tcggtacccg gggatcctct agagtcgacc tgcaggcatg caagcttgct
     cccgccgtcg ttttacaacg tcgtgactgg gaaaaccctg gcgttaccca acttaatcgc
     cttgcagcac atcccccttt cgccagctgg cgtaatagcg aagaggcccg caccgatcgc
     ccttcccaac agttgcgcag cctgaatggc gaatggcgct ttgcctggtt tccggcacca
     gaagcggtgc cggaaagctg gctggagtgc gatcttcctg aggccgatac tgtcgtcgtc
     ccctcaaact ggcagatgca cggttacgat gcgcccatct acaccaacgt aacctatccc
     attacggtca atccgccgtt tgttcccacg gagaatccga cgggttgtta ctcgctcaca
     tttaatgttg atgaaagctg gctacaggaa ggccagacgc gaattatttt tgatggcgtt
     aactcggcgt ttcatctgtg gtgcaacggg cgctgggtcg gttacggcca ggacagtcgt
     ttgccgtctg aatttgacct gagcgcattt ttacgcgccg gagaaaaccg cctcgcggtg
     atggtgctgc gttggagtga cggcagttat ctggaagatc aggatatgtg gcggatgagc
     ggcattttcc gtgacgtctc gttgctgcat aaaccgacta cacaaatcag cgatttccat
     gttgccactc gctttaatga tgatttcagc cgcgctgtac tggaggctga agttcagatg
     tgcggcgagt tgcgtgacta cctacgggta acagtttctt tatggcaggg tgaaacgcag
     gtcgccagcg gcaccgcgcc tttcggcggt gaaattatcg atgagcgtgg tggttatgcc
     gatcgcgtca cactacgtct gaacgtcgaa aacccgaaac tgtggagcgc cgaaatcccg
     aatctctatc gtgcggtggt tgaactgcac accgccgacg gcacgctgat tgaagcagaa
     gcctgcgatg tcggtttccg cgaggtgcgg attgaaaatg gtctgctgct gctgaacggc
     aagccgttgc tgattcgagg cgttaaccgt cacgagcatc atcctctgca tggtcaggtc
     atggatgagc agacgatggt gcaggatatc ctgctgatga agcagaacaa ctttaacgcc
     gtgcgctgtt cgcattatcc gaaccatccg ctgtggtaca cgctgtgcga ccgctacggc
     ctgtatgtgg tggatgaagc caatattgaa acccacggca tggtgccaat gaatcgtctg
     accgatgatc cgcgctggct accggcgatg agcgaacgcg taacgcgaat ggtgcagcgc
     gatcgtaatc acccgagtgt gatcatctgg tcgctgggga atgaatcagg ccacggcgct
     aatcacgacg cgctgtatcg ctggatcaaa tctgtcgatc cttcccgccc ggtgcagtat
     gaaggcggcg gagccgacac cacggccacc gatattattt gcccgatgta cgcgcgcgtg
     gatgaagacc agcccttccc ggctgtgccg aaatggtcca tcaaaaaatg gctttcgcta
     cctggagaga cgcgcccgct gatcctttgc gaatacgccc acgcgatggg taacagtctt
     ggcggtttcg ctaaatactg gcaggcgttt cgtcagtatc cccgtttaca gggcggcttc
     gtctgggact gggtggatca gtcgctgatt aaatatgatg aaaacggcaa cccgtggtcg
     gcttacggcg gtgattttgg cgatacgccg aacgatcgcc agttctgtat gaacggtctg
     gtctttgccg accgcacgcc gcatccagcg ctgacggaag caaaacacca gcagcagttt
     ttccagttcc gtttatccgg gcaaaccatc gaagtgacca gcgaatacct gttccgtcat
     agcgataacg agctcctgca ctggatggtg gcgctggatg gtaagccgct ggcaagcggt
     gaagtgcctc tggatgtcgc tccacaaggt aaacagttga ttgaactgcc tgaactaccg
     cagccggaga gcgccgggca actctggctc acagtacgcg tagtgcaacc gaacgcgacc
     gcatggtcag aagccgggca catcagcgcc tggcagcagt ggcgtctggc ggaaaacctc
     agtgtgacgc tccccgccgc gtcccacgcc atcccgcatc tgaccaccag cgaaatggat
     ttttgcatcg agctgggtaa taagcgttgg caatttaacc gccagtcagg ctttctttca
     cagatgtgga ttggcgataa aaaacaactg ctgacgccgc tgcgcgatca gttcacccgt
     gcaccgctgg ataacgacat tggcgtaagt gaagcgaccc gcattgaccc taacgcctgg
     gtcgaacgct ggaaggcggc gggccattac caggccgaag cagcgttgtt gcagtgcacg
     gcagatacac ttgctgatgc ggtgctgatt acgaccgctc acgcgtggca gcatcagggg
     aaaaccttat ttatcagccg gaaaacctac cggattgatg gtagtggtca aatggcgatt
     accgttgatg ttgaagtggc gagcgataca ccgcatccgg cgcggattgg cctgaactgc
     cagctggcgc aggtagcaga gcgggtaaac tggctcggat tagggccgca agaaaactat
     cccgaccgcc ttactgccgc ctgttttgac cgctgggatc tgccattgtc agacatgtat
     accccgtacg tcttcccgag cgaaaacggt ctgcgctgcg ggacgcgcga attgaattat
     ggcccacacc agtggcgcgg cgacttccag ttcaacatca gccgctacag tcaacagcaa
     ctgatggaaa ccagccatcg ccatctgctg cacgcggaag aaggcacatg gctgaatatc
     gacggtttcc atatggggat tggtggcgac gactcctgga gcccgtcagt atcggcggaa
     ttccagctga gcgccggtcg ctaccattac cagttggtct ggtgtcaaaa ataataataa
     ccgggcaggc catgtctgcc cgtatttcgc gtaaggaaat ccattatgta ctatttcgcc
     tgatgcggta ttttctcctt acgcatctgt gcggtatttc acaccgcata gggtaataac
     tgatataatt aaattgaagc tctaatttgt gagtttagta tacatgcatt tacttataat
     acagtttttt agttttgctg gccgcatctt ctcaaatatg cttcccagcc tgcttttctg
     taacgttcac cctctacctt agcatccctt ccctttgcaa atagtcctct tccaacaata
     ataatgtcag atcctgtaga gaccacatca tccacggttc tatactgttg acccaatgcg
     tctcccttgt catctaaacc cacaccgggt gtcataatca accaatcgta accttcatct
     cttccaccca tgtctctttg agcaataaag ccgataacaa aatctttgtc gctcttcgca
     atgtcaacag tacccttagt atattctcca gtagataggg agcccttgca tgacaattct
     gctaacatca aaaggcctct aggttccttt gttacttctt ctgccgcctg cttcaaaccg
     ctaacaatac ctgggcccac cacaccgtgt gcattcgtaa tgtctgccca ttctgctatt
     ctgtatacac ccgcagagta ctgcaatttg actgtattac caatgtcagc aaattttctg
     tcttcgaaga gtaaaaaatt gtacttggcg gataatgcct ttagcggctt aactgtgccc
     tccatggaaa aatcagtcaa gatatccaca tgtgttttta gtaaacaaat tttgggacct
     aatgcttcaa ctaactccag taattccttg gtggtacgaa catccaatga agcacacaag
     tttgtttgct tttcgtgcat gatattaaat agcttggcag caacaggact aggatgagta
     gcagcacgtt ccttatatgt agctttcgac atgatttatc ttcgtttttt gttctgtgca
     gttgggttaa gaatactggg caatttcatg tttcttcaac actacatatg cgtatatata
     ccaatctaag tctgtgctcc ttccttcgtt cttccttctg ttcggagatt accgaatcaa
     aaaaatttca aagaaaccga aatcaaaaaa aagaataaaa aaaaaatgat gaattgaatt
     gaaaagctac ttgttaccca tcattgaatt ttgaacatcc gaacctggga gttttccctg
     aaacagatag tatatttgaa cctgtataat aatatatagt ctagcgcttt acggaagaca
     atgtatgtat ttcggttcct ggagaaacta ttgcatctat tgcataggta atcttgcacg
     tcgcatcccc ggttcatttt ctgcgtttcc atcttgcact tcaatagcat atctttgtta
     acgaagcatc tgtgcttcat tttgtagaac aaaaatgcaa cgcgagagcg ctaatttttc
     aaacaaagaa tctgagctgc atttttacag aacagaaatg caacgcgaaa gcgctatttt
     accaacgaag aatctgtgct tcatttttgt aaaacaaaaa tgcaacgcga gagcgctaat
     ttttcaaaca aagaatctga gctgcatttt tacagaacag aaatgcaacg cgagagcgct
     attttaccaa caaagaatct atacttcttt tttgttctac aaaaatgcat cccgagagcg
     ctatttttct aacaaagcat cttagattac tttttttctc ctttgtgcgc tctataatgc
     agtctcttga taactttttg cactgtaggt ccgttaaggt tagaagaagg ctactttggt
     gtctattttc tcttccataa aaaaagcctg actccacttc ccgcgtttac tgattactag
     cgaagctgcg ggtgcatttt ttcaagataa aggcatcccc gattatattc tataccgatg
     tggattgcgc atactttgtg aacagaaagt gatagcgttg atgattcttc attggtcaga
     aaattatgaa cggtttcttc tattttgtct ctatatacta cgtataggaa atgtttacat
     tttcgtattg ttttcgattc actctatgaa tagttcttac tacaattttt ttgtctaaag
     agtaatacta gagataaaca taaaaaatgt agaggtcgag tttagatgca agttcaagga
     gcgaaaggtg gatgggtagg ttatataggg atatagcaca gagatatata gcaaagagat
     acttttgagc aatgtttgtg gaagcggtat tcgcaatatt ttagtagctc gttacagtcc
     ggtgcgtttt tggttttttg aaagtgcgtc ttcagagcgc ttttggtttt caaaagcgct
     ctgaagttcc tatactttct agctagagaa taggaacttc ggaataggaa cttcaaagcg
     tttccgaaaa cgagcgcttc cgaaaatgca acgcgagctg cgcacataca gctcactgtt
     cacgtcgcac ctatatctgc gtgttgcctg tatatatata tacatgagaa gaacggcata
     gtgcgtgttt atgcttaaat gcgttatggt gcactctcag tacaatctgc tctgatgccg
     catagttaag ccagccccga cacccgccaa cacccgctga cgcgccctga cgggcttgtc
     tgctcccggc atccgcttac agacaagctg tgaccgtctc cgggagctgc atgtgtcaga
     ggttttcacc gtcatcaccg aaacgcgcga gacgaaaggg cctcgtgata cgcctatttt
     tataggttaa tgtcatgata ataatggttt cttagacgtc aggtggcact tttcggggaa
     atgtgcgcgg aacccctatt tgtttatttt tctaaataca ttcaaatatg tatccgctca
     tgagacaata accctgataa atgcttcaat aatattgaaa aaggaagagt atgagtattc
     aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct gtttttgctc
     acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca cgagtgggtt
     acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc gaagaacgtt
     ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc cgtattgacg
     ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg gttgagtact
     caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta tgcagtgctg
     ccataaccat gagtgataac actgcggcca acttacttct gacaacgatc ggaggaccga
     aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt gatcgttggg
     aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg cctgtagcaa
     tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct tcccggcaac
     aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc tcggcccttc
     cggctggctg gtttattgct gataaatctg gagccggtga gcgtgggtct cgcggtatca
     ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctac acgacgggga
     gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc tcactgatta
     agcattggta actgtcagac caagtttact catatatact ttagattgat ttaaaacttc
     atttttaatt taaaaggatc taggtgaaga tcctttttga taatctcatg accaaaatcc
     cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc aaaggatctt
     cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac
     cagcggtggt ttgtttgccg gatcaagagc taccaactct ttttccgaag gtaactggct
     tcagcagagc gcagatacca aatactgtcc ttctagtgta gccgtagtta ggccaccact
     tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta ccagtggctg
     ctgccagtgg cgataagtcg tgtcttaccg ggttggactc aagacgatag ttaccggata
     aggcgcagcg gtcgggctga acggggggtt cgtgcacaca gcccagcttg gagcgaacga
     cctacaccga actgagatac ctacagcgtg agcattgaga aagcgccacg cttcccgaag
     ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg
     agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc cacctctgac
     ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa aacgccagca
     acgcggcctt tttacggttc ctggcctttt gctggccttt tgctcacatg ttctttcctg
     cgttatcccc tgattctgtg gataaccgta ttaccgcctt tgagtgagct gataccgctc
     gccgcagccg aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa gagcgcccaa
     tacgcaaacc gcctctcccc gcgcgttggc cgattcattc ccg
//