back Return to this vector's summary.
ID   YEP357R    preliminary; circular DNA; SYN; 7981 BP.
XX
AC   ATCC37738;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli plasmid vector YEp357R - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   YEp352E from YEp352 & linker
RC   YEp363A from pNM480 & YEp351
RC   YEp353A from pNM480 & YEp352
RC   YEp353 from YEp353A & YEp352E
RC   YEp354A from pNM481 & YEp352
RC   YEp354 from YEp354A & YEp352E
RC   YEp355A from pNM482 & YEp352
RC   YEp355 from YEp355A & YEp352E
RC   YEp356, YEp356R from YEp353 & pUC18
RC   YEp357, YEp357R from YEp354 & pUC18
RC   YEp358, YEp358R from YEp355 & pUC18
RC   YEp363 from YEp363A & YEp353
RC   YEp364 from YEp363A & YEp354
RC   YEp365 from YEp363A & YEp355
RC   YEp366 from YEp363A & YEp356
RC   YEp367 from YEp363A & YEp357
RC   YEp368 from YEp363A & YEp358
RC   YEp366R from YEp363A & YEp356R
RC   YEp367R from YEp363A & YEp357R
RC   YEp368R from YEp363A & YEp358R
RC   YIp353 from YEp353 & YIp352
RC   YIp354 from YEp354 & YIp352
RC   YIp355 from YEp355 & YIp352
RC   YIp356 from YEp356 & YIp352
RC   YIp357 from YEp357 & YIp352
RC   YIp358 from YEp358 & YIp352
RC   YIp356R from YEp356R & YIp352
RC   YIp357R from YEp357R & YIp352
RC   YIp358R from YEp358R & YIp352
RC   YIp363 from YEp363 & YIp351
RC   YIp364 from YEp364 & YIp351
RC   YIp365 from YEp365 & YIp351
RC   YIp366 from YEp366 & YIp351
RC   YIp367 from YEp367 & YIp351
RC   YIp368 from YEp368 & YIp351
RC   YIp366R from YEp366R & YIp351
RC   YIp367R from YEp367R & YIp351
RC   YIp368R from YEp368R & YIp351
RA   Myers A.M., Tzagoloff A., Kinney D.M., Lusty C.J.;
RT   "Yeast shuttle and integrative vectors with multiple cloning sites
RT   suitable for construction of lacZ fusions";
RL   Gene 45:299-310(1986).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   The sequence and reading frame of the multiple cloning sequence is:
CC   5' A AGC TTG CAT GCC TGC AGG TCG ACT CTA GAG GAT CCC CGG GTA CCG AGC
CC   TCG AAT TCC CAG CTT GCT CCC 3', from nucleotide 1 of MCS through CCC
CC   for amino acid 8 of beta-galactosidase.
CC   One of 3 promoter-cloning, YE type shuttle vectors (ATCC 37737 to
CC   ATCC 37739) with URA3 selection in Saccharomyces cerevisiae, a
CC   beta-galactosidase reporter gene and multiple cloning sites differing
CC   in reading frame.
CC   The cleavage position in the reading frame for cloning sites is (where
CC   3 = between triplets): HindIII-3; SphI-1; PstI-1; SalI-3; XbaI-3;
CC   BamHI-3; SmaI-1; KpnI-1; SacI-1; EcoRI-3. The SacI site is not unique.
CC   Restriction digests of the clone give the following sizes (kb):
CC   HindIII--8.0; EcorI--8.0; PstI--8.0. (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (YEp357R)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli HB101)(Saccharomyces cerevisiae)(E.coli)(E.coli MC1061)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (YEp354)(pUC18)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. YEp354 remove EcoRI-HindIII 30bp 2..32, MCS
FT                   \ 7914bp
FT                   Klenow:Klenow
FT                   2. pUC18 HindIII-EcoRI 51bp 400..451, MCS
FT                   HpaII methylase [to protect SmaI]
FT                   EcoRI-SmaI linker 10bp gaatcccggg:HindIII-SmaI linker
FT                   \ 13bp aagcttcccggga
FT                   SmaI-SmaI, MCS
FT                   -> YEp357R 7965bp"
FT   -               1..5
FT                   /note="YEp353 1..5 5bp
FT                   EcoRI = G^AATT C
FT                   \              gggaatt..."
FT   -               6..70
FT                   /note="65bp
FT                   \ gggaattcgagctcggtacccggggatcctctagagtcgacctgcaggca
FT                   \ gcatgcaagcttccc
FT                   \ ...cttccc
FT                   HindIII = A^AGCTT"
FT   -               71..77
FT                   /note="YEp353 32..38 7bp"
FT   -               78..7981
FT                   /note="YEp353 41..7944 7904bp"
FT   misc_binding    0..0
FT                   /note="MCS HindIII-SphI-PstI-SalI-XbaI-BamHI-SmaI-
FT                   KpnI-SacI-EcoRI"
FT   misc_binding    0..0
FT                   /note="SIT unique HindIII-SphI-PstI-SalI-XbaI-BamHI-
FT                   SmaI-KpnI-EcoRI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   rep_origin      0..0
FT                   /note="ORI yeast 2 micron"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ);
FT                   reporter gene"
FT   CDS             0..0
FT                   /note="ANT yeast URA3 gene"
XX
SQ   Sequence 7981 BP; 1989 A; 1964 C; 1946 G; 2082 T; 0 other;
     gaattgggaa ttcgagctcg gtacccgggg atcctctaga gtcgacctgc aggcagcatg
     caagcttccc agcttgctcc cgccgtcgtt ttacaacgtc gtgactggga aaaccctggc
     gttacccaac ttaatcgcct tgcagcacat ccccctttcg ccagctggcg taatagcgaa
     gaggcccgca ccgatcgccc ttcccaacag ttgcgcagcc tgaatggcga atggcgcttt
     gcctggtttc cggcaccaga agcggtgccg gaaagctggc tggagtgcga tcttcctgag
     gccgatactg tcgtcgtccc ctcaaactgg cagatgcacg gttacgatgc gcccatctac
     accaacgtaa cctatcccat tacggtcaat ccgccgtttg ttcccacgga gaatccgacg
     ggttgttact cgctcacatt taatgttgat gaaagctggc tacaggaagg ccagacgcga
     attatttttg atggcgttaa ctcggcgttt catctgtggt gcaacgggcg ctgggtcggt
     tacggccagg acagtcgttt gccgtctgaa tttgacctga gcgcattttt acgcgccgga
     gaaaaccgcc tcgcggtgat ggtgctgcgt tggagtgacg gcagttatct ggaagatcag
     gatatgtggc ggatgagcgg cattttccgt gacgtctcgt tgctgcataa accgactaca
     caaatcagcg atttccatgt tgccactcgc tttaatgatg atttcagccg cgctgtactg
     gaggctgaag ttcagatgtg cggcgagttg cgtgactacc tacgggtaac agtttcttta
     tggcagggtg aaacgcaggt cgccagcggc accgcgcctt tcggcggtga aattatcgat
     gagcgtggtg gttatgccga tcgcgtcaca ctacgtctga acgtcgaaaa cccgaaactg
     tggagcgccg aaatcccgaa tctctatcgt gcggtggttg aactgcacac cgccgacggc
     acgctgattg aagcagaagc ctgcgatgtc ggtttccgcg aggtgcggat tgaaaatggt
     ctgctgctgc tgaacggcaa gccgttgctg attcgaggcg ttaaccgtca cgagcatcat
     cctctgcatg gtcaggtcat ggatgagcag acgatggtgc aggatatcct gctgatgaag
     cagaacaact ttaacgccgt gcgctgttcg cattatccga accatccgct gtggtacacg
     ctgtgcgacc gctacggcct gtatgtggtg gatgaagcca atattgaaac ccacggcatg
     gtgccaatga atcgtctgac cgatgatccg cgctggctac cggcgatgag cgaacgcgta
     acgcgaatgg tgcagcgcga tcgtaatcac ccgagtgtga tcatctggtc gctggggaat
     gaatcaggcc acggcgctaa tcacgacgcg ctgtatcgct ggatcaaatc tgtcgatcct
     tcccgcccgg tgcagtatga aggcggcgga gccgacacca cggccaccga tattatttgc
     ccgatgtacg cgcgcgtgga tgaagaccag cccttcccgg ctgtgccgaa atggtccatc
     aaaaaatggc tttcgctacc tggagagacg cgcccgctga tcctttgcga atacgcccac
     gcgatgggta acagtcttgg cggtttcgct aaatactggc aggcgtttcg tcagtatccc
     cgtttacagg gcggcttcgt ctgggactgg gtggatcagt cgctgattaa atatgatgaa
     aacggcaacc cgtggtcggc ttacggcggt gattttggcg atacgccgaa cgatcgccag
     ttctgtatga acggtctggt ctttgccgac cgcacgccgc atccagcgct gacggaagca
     aaacaccagc agcagttttt ccagttccgt ttatccgggc aaaccatcga agtgaccagc
     gaatacctgt tccgtcatag cgataacgag ctcctgcact ggatggtggc gctggatggt
     aagccgctgg caagcggtga agtgcctctg gatgtcgctc cacaaggtaa acagttgatt
     gaactgcctg aactaccgca gccggagagc gccgggcaac tctggctcac agtacgcgta
     gtgcaaccga acgcgaccgc atggtcagaa gccgggcaca tcagcgcctg gcagcagtgg
     cgtctggcgg aaaacctcag tgtgacgctc cccgccgcgt cccacgccat cccgcatctg
     accaccagcg aaatggattt ttgcatcgag ctgggtaata agcgttggca atttaaccgc
     cagtcaggct ttctttcaca gatgtggatt ggcgataaaa aacaactgct gacgccgctg
     cgcgatcagt tcacccgtgc accgctggat aacgacattg gcgtaagtga agcgacccgc
     attgacccta acgcctgggt cgaacgctgg aaggcggcgg gccattacca ggccgaagca
     gcgttgttgc agtgcacggc agatacactt gctgatgcgg tgctgattac gaccgctcac
     gcgtggcagc atcaggggaa aaccttattt atcagccgga aaacctaccg gattgatggt
     agtggtcaaa tggcgattac cgttgatgtt gaagtggcga gcgatacacc gcatccggcg
     cggattggcc tgaactgcca gctggcgcag gtagcagagc gggtaaactg gctcggatta
     gggccgcaag aaaactatcc cgaccgcctt actgccgcct gttttgaccg ctgggatctg
     ccattgtcag acatgtatac cccgtacgtc ttcccgagcg aaaacggtct gcgctgcggg
     acgcgcgaat tgaattatgg cccacaccag tggcgcggcg acttccagtt caacatcagc
     cgctacagtc aacagcaact gatggaaacc agccatcgcc atctgctgca cgcggaagaa
     ggcacatggc tgaatatcga cggtttccat atggggattg gtggcgacga ctcctggagc
     ccgtcagtat cggcggaatt ccagctgagc gccggtcgct accattacca gttggtctgg
     tgtcaaaaat aataataacc gggcaggcca tgtctgcccg tatttcgcgt aaggaaatcc
     attatgtact atttcgcctg atgcggtatt ttctccttac gcatctgtgc ggtatttcac
     accgcatagg gtaataactg atataattaa attgaagctc taatttgtga gtttagtata
     catgcattta cttataatac agttttttag ttttgctggc cgcatcttct caaatatgct
     tcccagcctg cttttctgta acgttcaccc tctaccttag catcccttcc ctttgcaaat
     agtcctcttc caacaataat aatgtcagat cctgtagaga ccacatcatc cacggttcta
     tactgttgac ccaatgcgtc tcccttgtca tctaaaccca caccgggtgt cataatcaac
     caatcgtaac cttcatctct tccacccatg tctctttgag caataaagcc gataacaaaa
     tctttgtcgc tcttcgcaat gtcaacagta cccttagtat attctccagt agatagggag
     cccttgcatg acaattctgc taacatcaaa aggcctctag gttcctttgt tacttcttct
     gccgcctgct tcaaaccgct aacaatacct gggcccacca caccgtgtgc attcgtaatg
     tctgcccatt ctgctattct gtatacaccc gcagagtact gcaatttgac tgtattacca
     atgtcagcaa attttctgtc ttcgaagagt aaaaaattgt acttggcgga taatgccttt
     agcggcttaa ctgtgccctc catggaaaaa tcagtcaaga tatccacatg tgtttttagt
     aaacaaattt tgggacctaa tgcttcaact aactccagta attccttggt ggtacgaaca
     tccaatgaag cacacaagtt tgtttgcttt tcgtgcatga tattaaatag cttggcagca
     acaggactag gatgagtagc agcacgttcc ttatatgtag ctttcgacat gatttatctt
     cgttttttgt tctgtgcagt tgggttaaga atactgggca atttcatgtt tcttcaacac
     tacatatgcg tatatatacc aatctaagtc tgtgctcctt ccttcgttct tccttctgtt
     cggagattac cgaatcaaaa aaatttcaaa gaaaccgaaa tcaaaaaaaa gaataaaaaa
     aaaatgatga attgaattga aaagctactt gttacccatc attgaatttt gaacatccga
     acctgggagt tttccctgaa acagatagta tatttgaacc tgtataataa tatatagtct
     agcgctttac ggaagacaat gtatgtattt cggttcctgg agaaactatt gcatctattg
     cataggtaat cttgcacgtc gcatccccgg ttcattttct gcgtttccat cttgcacttc
     aatagcatat ctttgttaac gaagcatctg tgcttcattt tgtagaacaa aaatgcaacg
     cgagagcgct aatttttcaa acaaagaatc tgagctgcat ttttacagaa cagaaatgca
     acgcgaaagc gctattttac caacgaagaa tctgtgcttc atttttgtaa aacaaaaatg
     caacgcgaga gcgctaattt ttcaaacaaa gaatctgagc tgcattttta cagaacagaa
     atgcaacgcg agagcgctat tttaccaaca aagaatctat acttcttttt tgttctacaa
     aaatgcatcc cgagagcgct atttttctaa caaagcatct tagattactt tttttctcct
     ttgtgcgctc tataatgcag tctcttgata actttttgca ctgtaggtcc gttaaggtta
     gaagaaggct actttggtgt ctattttctc ttccataaaa aaagcctgac tccacttccc
     gcgtttactg attactagcg aagctgcggg tgcatttttt caagataaag gcatccccga
     ttatattcta taccgatgtg gattgcgcat actttgtgaa cagaaagtga tagcgttgat
     gattcttcat tggtcagaaa attatgaacg gtttcttcta ttttgtctct atatactacg
     tataggaaat gtttacattt tcgtattgtt ttcgattcac tctatgaata gttcttacta
     caattttttt gtctaaagag taatactaga gataaacata aaaaatgtag aggtcgagtt
     tagatgcaag ttcaaggagc gaaaggtgga tgggtaggtt atatagggat atagcacaga
     gatatatagc aaagagatac ttttgagcaa tgtttgtgga agcggtattc gcaatatttt
     agtagctcgt tacagtccgg tgcgtttttg gttttttgaa agtgcgtctt cagagcgctt
     ttggttttca aaagcgctct gaagttccta tactttctag ctagagaata ggaacttcgg
     aataggaact tcaaagcgtt tccgaaaacg agcgcttccg aaaatgcaac gcgagctgcg
     cacatacagc tcactgttca cgtcgcacct atatctgcgt gttgcctgta tatatatata
     catgagaaga acggcatagt gcgtgtttat gcttaaatgc gttatggtgc actctcagta
     caatctgctc tgatgccgca tagttaagcc agccccgaca cccgccaaca cccgctgacg
     cgccctgacg ggcttgtctg ctcccggcat ccgcttacag acaagctgtg accgtctccg
     ggagctgcat gtgtcagagg ttttcaccgt catcaccgaa acgcgcgaga cgaaagggcc
     tcgtgatacg cctattttta taggttaatg tcatgataat aatggtttct tagacgtcag
     gtggcacttt tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt
     caaatatgta tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa
     ggaagagtat gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt
     gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt
     tgggtgcacg agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt
     ttcgccccga agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg
     tattatcccg tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga
     atgacttggt tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa
     gagaattatg cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga
     caacgatcgg aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa
     ctcgccttga tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca
     ccacgatgcc tgtagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta
     ctctagcttc ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac
     ttctgcgctc ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc
     gtgggtctcg cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag
     ttatctacac gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga
     taggtgcctc actgattaag cattggtaac tgtcagacca agtttactca tatatacttt
     agattgattt aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata
     atctcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag
     aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa
     caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt
     ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc
     cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa
     tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa
     gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc
     ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag cattgagaaa
     gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa
     caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg
     ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc
     tatggaaaaa cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg
     ctcacatgtt ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg
     agtgagctga taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg
     aagcggaaga gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattccc
     g
//