back Return to this vector's summary.
ID   YEP358     preliminary; circular DNA; SYN; 7964 BP.
XX
AC   ATCC37733;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli plasmid vector YEp358 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   YEp352E from YEp352 & linker
RC   YEp363A from pNM480 & YEp351
RC   YEp353A from pNM480 & YEp352
RC   YEp353 from YEp353A & YEp352E
RC   YEp354A from pNM481 & YEp352
RC   YEp354 from YEp354A & YEp352E
RC   YEp355A from pNM482 & YEp352
RC   YEp355 from YEp355A & YEp352E
RC   YEp356, YEp356R from YEp353 & pUC18
RC   YEp357, YEp357R from YEp354 & pUC18
RC   YEp358, YEp358R from YEp355 & pUC18
RC   YEp363 from YEp363A & YEp353
RC   YEp364 from YEp363A & YEp354
RC   YEp365 from YEp363A & YEp355
RC   YEp366 from YEp363A & YEp356
RC   YEp367 from YEp363A & YEp357
RC   YEp368 from YEp363A & YEp358
RC   YEp366R from YEp363A & YEp356R
RC   YEp367R from YEp363A & YEp357R
RC   YEp368R from YEp363A & YEp358R
RC   YIp353 from YEp353 & YIp352
RC   YIp354 from YEp354 & YIp352
RC   YIp355 from YEp355 & YIp352
RC   YIp356 from YEp356 & YIp352
RC   YIp357 from YEp357 & YIp352
RC   YIp358 from YEp358 & YIp352
RC   YIp356R from YEp356R & YIp352
RC   YIp357R from YEp357R & YIp352
RC   YIp358R from YEp358R & YIp352
RC   YIp363 from YEp363 & YIp351
RC   YIp364 from YEp364 & YIp351
RC   YIp365 from YEp365 & YIp351
RC   YIp366 from YEp366 & YIp351
RC   YIp367 from YEp367 & YIp351
RC   YIp368 from YEp368 & YIp351
RC   YIp366R from YEp366R & YIp351
RC   YIp367R from YEp367R & YIp351
RC   YIp368R from YEp368R & YIp351
RA   Myers A.M., Tzagoloff A., Kinney D.M., Lusty C.J.;
RT   "Yeast shuttle and integrative vectors with multiple cloning sites
RT   suitable for construction of lacZ fusions";
RL   Gene 45:299-310(1986).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   The sequence and reading frame of the multiple cloning sequence is:
CC   5' G AAT TCG AGC TCG GTA CCC GGG GAT CCT CTA GAG TCG ACC TGC AGG CAT
CC   GCA AGC TTC GAT CCC 3', from nucleotide 1 of MCS through CCC for amino
CC   acid 8 of beta-galactosidase.
CC   One of 3 promoter-cloning, YE type shuttle vectors (ATCC 37731 to
CC   ATCC 37733) with URA3 selection in Saccharomyces cerevisiae, a
CC   beta-galactosidase reporter gene and multiple cloning sites differing
CC   in reading frame.
CC   The cleavage position in the reading frame for cloning sites is (where
CC   3 = between triplets): EcoRI-3; SacI-1; KpnI-1; SmaI-3; BamHI-3;
CC   XbaI-3; SalI-3; PstI-1; SphI-1; HindIII-3. The SacI site is not
CC   unique.
CC   Restriction digests of the clone give the following sizes (kb):
CC   HindIII--8.0; EcoRI--8.0. (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (YEp358)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli HB101)(Saccharomyces cerevisiae)(E.coli)(E.coli MC1061)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (YEp355)(pUC18)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. YEp355 remove EcoRI-HindIII 30bp 2..32, MCS
FT                   \ 7914bp
FT                   2. pUC18 HindIII-EcoRI 51bp 400..451, MCS
FT                   -> YEp358 7965bp"
FT   -               1..1
FT                   /note="YEp353 1..1 1bp
FT                   EcoRI = G^AATTC
FT                   \         aattc..."
FT   -               2..52
FT                   /note="51bp
FT                   \ aattcgagctcggtacccggggatcctctagagtcgacctgcaggcatgca
FT                   \  ...atgca
FT                   HindIII = A^AGCTT"
FT   -               53..57
FT                   /note="YEp353 32..36 5bp"
FT   -               58..7964
FT                   /note="YEp353 38..7944 7907bp"
FT   misc_binding    0..0
FT                   /note="MCS EcoRI-SacI-KpnI-SmaI-BamHI-XbaI-SalI-
FT                   PstI-SphI-HindIII"
FT   misc_binding    0..0
FT                   /note="SIT unique EcoRI-KpnI-SmaI-BamHI-XbaI-SalI-
FT                   PstI-SphI-HindIII"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   rep_origin      0..0
FT                   /note="ORI yeast 2 micron"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ);
FT                   reporter gene"
FT   CDS             0..0
FT                   /note="ANT yeast URA3 gene"
XX
SQ   Sequence 7964 BP; 1986 A; 1959 C; 1941 G; 2078 T; 0 other;
     gaattcgagc tcggtacccg gggatcctct agagtcgacc tgcaggcatg caagcttcga
     tcccgccgtc gttttacaac gtcgtgactg ggaaaaccct ggcgttaccc aacttaatcg
     ccttgcagca catccccctt tcgccagctg gcgtaatagc gaagaggccc gcaccgatcg
     cccttcccaa cagttgcgca gcctgaatgg cgaatggcgc tttgcctggt ttccggcacc
     agaagcggtg ccggaaagct ggctggagtg cgatcttcct gaggccgata ctgtcgtcgt
     cccctcaaac tggcagatgc acggttacga tgcgcccatc tacaccaacg taacctatcc
     cattacggtc aatccgccgt ttgttcccac ggagaatccg acgggttgtt actcgctcac
     atttaatgtt gatgaaagct ggctacagga aggccagacg cgaattattt ttgatggcgt
     taactcggcg tttcatctgt ggtgcaacgg gcgctgggtc ggttacggcc aggacagtcg
     tttgccgtct gaatttgacc tgagcgcatt tttacgcgcc ggagaaaacc gcctcgcggt
     gatggtgctg cgttggagtg acggcagtta tctggaagat caggatatgt ggcggatgag
     cggcattttc cgtgacgtct cgttgctgca taaaccgact acacaaatca gcgatttcca
     tgttgccact cgctttaatg atgatttcag ccgcgctgta ctggaggctg aagttcagat
     gtgcggcgag ttgcgtgact acctacgggt aacagtttct ttatggcagg gtgaaacgca
     ggtcgccagc ggcaccgcgc ctttcggcgg tgaaattatc gatgagcgtg gtggttatgc
     cgatcgcgtc acactacgtc tgaacgtcga aaacccgaaa ctgtggagcg ccgaaatccc
     gaatctctat cgtgcggtgg ttgaactgca caccgccgac ggcacgctga ttgaagcaga
     agcctgcgat gtcggtttcc gcgaggtgcg gattgaaaat ggtctgctgc tgctgaacgg
     caagccgttg ctgattcgag gcgttaaccg tcacgagcat catcctctgc atggtcaggt
     catggatgag cagacgatgg tgcaggatat cctgctgatg aagcagaaca actttaacgc
     cgtgcgctgt tcgcattatc cgaaccatcc gctgtggtac acgctgtgcg accgctacgg
     cctgtatgtg gtggatgaag ccaatattga aacccacggc atggtgccaa tgaatcgtct
     gaccgatgat ccgcgctggc taccggcgat gagcgaacgc gtaacgcgaa tggtgcagcg
     cgatcgtaat cacccgagtg tgatcatctg gtcgctgggg aatgaatcag gccacggcgc
     taatcacgac gcgctgtatc gctggatcaa atctgtcgat ccttcccgcc cggtgcagta
     tgaaggcggc ggagccgaca ccacggccac cgatattatt tgcccgatgt acgcgcgcgt
     ggatgaagac cagcccttcc cggctgtgcc gaaatggtcc atcaaaaaat ggctttcgct
     acctggagag acgcgcccgc tgatcctttg cgaatacgcc cacgcgatgg gtaacagtct
     tggcggtttc gctaaatact ggcaggcgtt tcgtcagtat ccccgtttac agggcggctt
     cgtctgggac tgggtggatc agtcgctgat taaatatgat gaaaacggca acccgtggtc
     ggcttacggc ggtgattttg gcgatacgcc gaacgatcgc cagttctgta tgaacggtct
     ggtctttgcc gaccgcacgc cgcatccagc gctgacggaa gcaaaacacc agcagcagtt
     tttccagttc cgtttatccg ggcaaaccat cgaagtgacc agcgaatacc tgttccgtca
     tagcgataac gagctcctgc actggatggt ggcgctggat ggtaagccgc tggcaagcgg
     tgaagtgcct ctggatgtcg ctccacaagg taaacagttg attgaactgc ctgaactacc
     gcagccggag agcgccgggc aactctggct cacagtacgc gtagtgcaac cgaacgcgac
     cgcatggtca gaagccgggc acatcagcgc ctggcagcag tggcgtctgg cggaaaacct
     cagtgtgacg ctccccgccg cgtcccacgc catcccgcat ctgaccacca gcgaaatgga
     tttttgcatc gagctgggta ataagcgttg gcaatttaac cgccagtcag gctttctttc
     acagatgtgg attggcgata aaaaacaact gctgacgccg ctgcgcgatc agttcacccg
     tgcaccgctg gataacgaca ttggcgtaag tgaagcgacc cgcattgacc ctaacgcctg
     ggtcgaacgc tggaaggcgg cgggccatta ccaggccgaa gcagcgttgt tgcagtgcac
     ggcagataca cttgctgatg cggtgctgat tacgaccgct cacgcgtggc agcatcaggg
     gaaaacctta tttatcagcc ggaaaaccta ccggattgat ggtagtggtc aaatggcgat
     taccgttgat gttgaagtgg cgagcgatac accgcatccg gcgcggattg gcctgaactg
     ccagctggcg caggtagcag agcgggtaaa ctggctcgga ttagggccgc aagaaaacta
     tcccgaccgc cttactgccg cctgttttga ccgctgggat ctgccattgt cagacatgta
     taccccgtac gtcttcccga gcgaaaacgg tctgcgctgc gggacgcgcg aattgaatta
     tggcccacac cagtggcgcg gcgacttcca gttcaacatc agccgctaca gtcaacagca
     actgatggaa accagccatc gccatctgct gcacgcggaa gaaggcacat ggctgaatat
     cgacggtttc catatgggga ttggtggcga cgactcctgg agcccgtcag tatcggcgga
     attccagctg agcgccggtc gctaccatta ccagttggtc tggtgtcaaa aataataata
     accgggcagg ccatgtctgc ccgtatttcg cgtaaggaaa tccattatgt actatttcgc
     ctgatgcggt attttctcct tacgcatctg tgcggtattt cacaccgcat agggtaataa
     ctgatataat taaattgaag ctctaatttg tgagtttagt atacatgcat ttacttataa
     tacagttttt tagttttgct ggccgcatct tctcaaatat gcttcccagc ctgcttttct
     gtaacgttca ccctctacct tagcatccct tccctttgca aatagtcctc ttccaacaat
     aataatgtca gatcctgtag agaccacatc atccacggtt ctatactgtt gacccaatgc
     gtctcccttg tcatctaaac ccacaccggg tgtcataatc aaccaatcgt aaccttcatc
     tcttccaccc atgtctcttt gagcaataaa gccgataaca aaatctttgt cgctcttcgc
     aatgtcaaca gtacccttag tatattctcc agtagatagg gagcccttgc atgacaattc
     tgctaacatc aaaaggcctc taggttcctt tgttacttct tctgccgcct gcttcaaacc
     gctaacaata cctgggccca ccacaccgtg tgcattcgta atgtctgccc attctgctat
     tctgtataca cccgcagagt actgcaattt gactgtatta ccaatgtcag caaattttct
     gtcttcgaag agtaaaaaat tgtacttggc ggataatgcc tttagcggct taactgtgcc
     ctccatggaa aaatcagtca agatatccac atgtgttttt agtaaacaaa ttttgggacc
     taatgcttca actaactcca gtaattcctt ggtggtacga acatccaatg aagcacacaa
     gtttgtttgc ttttcgtgca tgatattaaa tagcttggca gcaacaggac taggatgagt
     agcagcacgt tccttatatg tagctttcga catgatttat cttcgttttt tgttctgtgc
     agttgggtta agaatactgg gcaatttcat gtttcttcaa cactacatat gcgtatatat
     accaatctaa gtctgtgctc cttccttcgt tcttccttct gttcggagat taccgaatca
     aaaaaatttc aaagaaaccg aaatcaaaaa aaagaataaa aaaaaaatga tgaattgaat
     tgaaaagcta cttgttaccc atcattgaat tttgaacatc cgaacctggg agttttccct
     gaaacagata gtatatttga acctgtataa taatatatag tctagcgctt tacggaagac
     aatgtatgta tttcggttcc tggagaaact attgcatcta ttgcataggt aatcttgcac
     gtcgcatccc cggttcattt tctgcgtttc catcttgcac ttcaatagca tatctttgtt
     aacgaagcat ctgtgcttca ttttgtagaa caaaaatgca acgcgagagc gctaattttt
     caaacaaaga atctgagctg catttttaca gaacagaaat gcaacgcgaa agcgctattt
     taccaacgaa gaatctgtgc ttcatttttg taaaacaaaa atgcaacgcg agagcgctaa
     tttttcaaac aaagaatctg agctgcattt ttacagaaca gaaatgcaac gcgagagcgc
     tattttacca acaaagaatc tatacttctt ttttgttcta caaaaatgca tcccgagagc
     gctatttttc taacaaagca tcttagatta ctttttttct cctttgtgcg ctctataatg
     cagtctcttg ataacttttt gcactgtagg tccgttaagg ttagaagaag gctactttgg
     tgtctatttt ctcttccata aaaaaagcct gactccactt cccgcgttta ctgattacta
     gcgaagctgc gggtgcattt tttcaagata aaggcatccc cgattatatt ctataccgat
     gtggattgcg catactttgt gaacagaaag tgatagcgtt gatgattctt cattggtcag
     aaaattatga acggtttctt ctattttgtc tctatatact acgtatagga aatgtttaca
     ttttcgtatt gttttcgatt cactctatga atagttctta ctacaatttt tttgtctaaa
     gagtaatact agagataaac ataaaaaatg tagaggtcga gtttagatgc aagttcaagg
     agcgaaaggt ggatgggtag gttatatagg gatatagcac agagatatat agcaaagaga
     tacttttgag caatgtttgt ggaagcggta ttcgcaatat tttagtagct cgttacagtc
     cggtgcgttt ttggtttttt gaaagtgcgt cttcagagcg cttttggttt tcaaaagcgc
     tctgaagttc ctatactttc tagctagaga ataggaactt cggaatagga acttcaaagc
     gtttccgaaa acgagcgctt ccgaaaatgc aacgcgagct gcgcacatac agctcactgt
     tcacgtcgca cctatatctg cgtgttgcct gtatatatat atacatgaga agaacggcat
     agtgcgtgtt tatgcttaaa tgcgttatgg tgcactctca gtacaatctg ctctgatgcc
     gcatagttaa gccagccccg acacccgcca acacccgctg acgcgccctg acgggcttgt
     ctgctcccgg catccgctta cagacaagct gtgaccgtct ccgggagctg catgtgtcag
     aggttttcac cgtcatcacc gaaacgcgcg agacgaaagg gcctcgtgat acgcctattt
     ttataggtta atgtcatgat aataatggtt tcttagacgt caggtggcac ttttcgggga
     aatgtgcgcg gaacccctat ttgtttattt ttctaaatac attcaaatat gtatccgctc
     atgagacaat aaccctgata aatgcttcaa taatattgaa aaaggaagag tatgagtatt
     caacatttcc gtgtcgccct tattcccttt tttgcggcat tttgccttcc tgtttttgct
     cacccagaaa cgctggtgaa agtaaaagat gctgaagatc agttgggtgc acgagtgggt
     tacatcgaac tggatctcaa cagcggtaag atccttgaga gttttcgccc cgaagaacgt
     tttccaatga tgagcacttt taaagttctg ctatgtggcg cggtattatc ccgtattgac
     gccgggcaag agcaactcgg tcgccgcata cactattctc agaatgactt ggttgagtac
     tcaccagtca cagaaaagca tcttacggat ggcatgacag taagagaatt atgcagtgct
     gccataacca tgagtgataa cactgcggcc aacttacttc tgacaacgat cggaggaccg
     aaggagctaa ccgctttttt gcacaacatg ggggatcatg taactcgcct tgatcgttgg
     gaaccggagc tgaatgaagc cataccaaac gacgagcgtg acaccacgat gcctgtagca
     atggcaacaa cgttgcgcaa actattaact ggcgaactac ttactctagc ttcccggcaa
     caattaatag actggatgga ggcggataaa gttgcaggac cacttctgcg ctcggccctt
     ccggctggct ggtttattgc tgataaatct ggagccggtg agcgtgggtc tcgcggtatc
     attgcagcac tggggccaga tggtaagccc tcccgtatcg tagttatcta cacgacgggg
     agtcaggcaa ctatggatga acgaaataga cagatcgctg agataggtgc ctcactgatt
     aagcattggt aactgtcaga ccaagtttac tcatatatac tttagattga tttaaaactt
     catttttaat ttaaaaggat ctaggtgaag atcctttttg ataatctcat gaccaaaatc
     ccttaacgtg agttttcgtt ccactgagcg tcagaccccg tagaaaagat caaaggatct
     tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc aaacaaaaaa accaccgcta
     ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc tttttccgaa ggtaactggc
     ttcagcagag cgcagatacc aaatactgtc cttctagtgt agccgtagtt aggccaccac
     ttcaagaact ctgtagcacc gcctacatac ctcgctctgc taatcctgtt accagtggct
     gctgccagtg gcgataagtc gtgtcttacc gggttggact caagacgata gttaccggat
     aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac agcccagctt ggagcgaacg
     acctacaccg aactgagata cctacagcgt gagcattgag aaagcgccac gcttcccgaa
     gggagaaagg cggacaggta tccggtaagc ggcagggtcg gaacaggaga gcgcacgagg
     gagcttccag ggggaaacgc ctggtatctt tatagtcctg tcgggtttcg ccacctctga
     cttgagcgtc gatttttgtg atgctcgtca ggggggcgga gcctatggaa aaacgccagc
     aacgcggcct ttttacggtt cctggccttt tgctggcctt ttgctcacat gttctttcct
     gcgttatccc ctgattctgt ggataaccgt attaccgcct ttgagtgagc tgataccgct
     cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg aggaagcgga agagcgccca
     atacgcaaac cgcctctccc cgcgcgttgg ccgattcatt cccg
//