back Return to this vector's summary.
ID   YEP358R    preliminary; circular DNA; SYN; 7982 BP.
XX
AC   ATCC37739;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli plasmid vector YEp358R - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   YEp352E from YEp352 & linker
RC   YEp363A from pNM480 & YEp351
RC   YEp353A from pNM480 & YEp352
RC   YEp353 from YEp353A & YEp352E
RC   YEp354A from pNM481 & YEp352
RC   YEp354 from YEp354A & YEp352E
RC   YEp355A from pNM482 & YEp352
RC   YEp355 from YEp355A & YEp352E
RC   YEp356, YEp356R from YEp353 & pUC18
RC   YEp357, YEp357R from YEp354 & pUC18
RC   YEp358, YEp358R from YEp355 & pUC18
RC   YEp363 from YEp363A & YEp353
RC   YEp364 from YEp363A & YEp354
RC   YEp365 from YEp363A & YEp355
RC   YEp366 from YEp363A & YEp356
RC   YEp367 from YEp363A & YEp357
RC   YEp368 from YEp363A & YEp358
RC   YEp366R from YEp363A & YEp356R
RC   YEp367R from YEp363A & YEp357R
RC   YEp368R from YEp363A & YEp358R
RC   YIp353 from YEp353 & YIp352
RC   YIp354 from YEp354 & YIp352
RC   YIp355 from YEp355 & YIp352
RC   YIp356 from YEp356 & YIp352
RC   YIp357 from YEp357 & YIp352
RC   YIp358 from YEp358 & YIp352
RC   YIp356R from YEp356R & YIp352
RC   YIp357R from YEp357R & YIp352
RC   YIp358R from YEp358R & YIp352
RC   YIp363 from YEp363 & YIp351
RC   YIp364 from YEp364 & YIp351
RC   YIp365 from YEp365 & YIp351
RC   YIp366 from YEp366 & YIp351
RC   YIp367 from YEp367 & YIp351
RC   YIp368 from YEp368 & YIp351
RC   YIp366R from YEp366R & YIp351
RC   YIp367R from YEp367R & YIp351
RC   YIp368R from YEp368R & YIp351
RA   Myers A.M., Tzagoloff A., Kinney D.M., Lusty C.J.;
RT   "Yeast shuttle and integrative vectors with multiple cloning sites
RT   suitable for construction of lacZ fusions";
RL   Gene 45:299-310(1986).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   The sequence and reading frame of the multiple cloning sequence is:
CC   5' AA GCT TGC ATG CCT GCA GGT CGA CTC TAG AGG ATC CCC GGG TAC CGA GCT
CC   CGA ATT CCC AGC TTC GAT CCC 3', from nucleotide 1 of MCS through CCC
CC   for amino acid 8 of beta-galactosidase.
CC   One of 3 promoter-cloning, YE type shuttle vectors (ATCC 37737 to
CC   ATCC 37739) with URA3 selection in Saccharomyces cerevisiae, a
CC   beta-galactosidase reporter gene and multiple cloning sites differing
CC   in reading frame.
CC   The cleavage position in the reading frame for cloning sites is (where
CC   3 = between triplets): HindIII-2; SphI-3; PstI-3; SalI-2; XbaI-2;
CC   BamHI-2; SmaI-3; KpnI-3; SacI-3; EcoRI-2. The SacI site is not unique.
CC   Cloning into the HindIII, SphI, PstI, SalI, or XbaI sites leads to a
CC   TAG stop codon within the downstream XbaI site of the multiple cloning
CC   region.
CC   Restriction digests of the clone give the following sizes (kb):
CC   HindIII--8.0; EcoRI--8.0; PstI--8.0. (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (YEp358R)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli HB101)(Saccharomyces cerevisiae)(E.coli)(E.coli MC1061)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (YEp355)(pUC18)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. YEp355 remove EcoRI-HindIII 30bp 2..32, MCS
FT                   Klenow:Klenow
FT                   2. pUC18 HindIII-EcoRI 51bp 400..451, MCS
FT                   HpaII methylase [to protect SmaI]
FT                   EcoRI-SmaI linker 10bp gaatcccggg:HindIII-SmaI linker
FT                   \ 13bp aagcttcccggga
FT                   SmaI-SmaI, MCS
FT                   -> YEp358R 7965bp"
FT   -               1..5
FT                   /note="YEp353 1..5 5bp
FT                   EcoRI = G^AATT C
FT                   \              gggaatt..."
FT   -               6..70
FT                   /note="65bp
FT                   \ gggaattcgagctcggtacccggggatcctctagagtcgacctgcaggca
FT                   \ gcatgcaagcttccc
FT                   \ ...cttccc
FT                   HindIII = A^AGCTT"
FT   -               71..75
FT                   /note="YEp353 32..36 5bp"
FT   -               76..7982
FT                   /note="YEp353 38..7944 7907bp"
FT   misc_binding    0..0
FT                   /note="MCS HindIII-SphI-PstI-SalI-XbaI-BamHI-SmaI-
FT                   KpnI-SacI-EcoRI"
FT   misc_binding    0..0
FT                   /note="SIT unique HindIII-SphI-PstI-SalI-XbaI-BamHI-
FT                   SmaI-KpnI-EcoRI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   rep_origin      0..0
FT                   /note="ORI yeast 2 micron"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ);
FT                   reporter gene"
FT   CDS             0..0
FT                   /note="ANT yeast URA3 gene"
XX
SQ   Sequence 7982 BP; 1990 A; 1964 C; 1946 G; 2082 T; 0 other;
     gaattgggaa ttcgagctcg gtacccgggg atcctctaga gtcgacctgc aggcagcatg
     caagcttccc agcttcgatc ccgccgtcgt tttacaacgt cgtgactggg aaaaccctgg
     cgttacccaa cttaatcgcc ttgcagcaca tccccctttc gccagctggc gtaatagcga
     agaggcccgc accgatcgcc cttcccaaca gttgcgcagc ctgaatggcg aatggcgctt
     tgcctggttt ccggcaccag aagcggtgcc ggaaagctgg ctggagtgcg atcttcctga
     ggccgatact gtcgtcgtcc cctcaaactg gcagatgcac ggttacgatg cgcccatcta
     caccaacgta acctatccca ttacggtcaa tccgccgttt gttcccacgg agaatccgac
     gggttgttac tcgctcacat ttaatgttga tgaaagctgg ctacaggaag gccagacgcg
     aattattttt gatggcgtta actcggcgtt tcatctgtgg tgcaacgggc gctgggtcgg
     ttacggccag gacagtcgtt tgccgtctga atttgacctg agcgcatttt tacgcgccgg
     agaaaaccgc ctcgcggtga tggtgctgcg ttggagtgac ggcagttatc tggaagatca
     ggatatgtgg cggatgagcg gcattttccg tgacgtctcg ttgctgcata aaccgactac
     acaaatcagc gatttccatg ttgccactcg ctttaatgat gatttcagcc gcgctgtact
     ggaggctgaa gttcagatgt gcggcgagtt gcgtgactac ctacgggtaa cagtttcttt
     atggcagggt gaaacgcagg tcgccagcgg caccgcgcct ttcggcggtg aaattatcga
     tgagcgtggt ggttatgccg atcgcgtcac actacgtctg aacgtcgaaa acccgaaact
     gtggagcgcc gaaatcccga atctctatcg tgcggtggtt gaactgcaca ccgccgacgg
     cacgctgatt gaagcagaag cctgcgatgt cggtttccgc gaggtgcgga ttgaaaatgg
     tctgctgctg ctgaacggca agccgttgct gattcgaggc gttaaccgtc acgagcatca
     tcctctgcat ggtcaggtca tggatgagca gacgatggtg caggatatcc tgctgatgaa
     gcagaacaac tttaacgccg tgcgctgttc gcattatccg aaccatccgc tgtggtacac
     gctgtgcgac cgctacggcc tgtatgtggt ggatgaagcc aatattgaaa cccacggcat
     ggtgccaatg aatcgtctga ccgatgatcc gcgctggcta ccggcgatga gcgaacgcgt
     aacgcgaatg gtgcagcgcg atcgtaatca cccgagtgtg atcatctggt cgctggggaa
     tgaatcaggc cacggcgcta atcacgacgc gctgtatcgc tggatcaaat ctgtcgatcc
     ttcccgcccg gtgcagtatg aaggcggcgg agccgacacc acggccaccg atattatttg
     cccgatgtac gcgcgcgtgg atgaagacca gcccttcccg gctgtgccga aatggtccat
     caaaaaatgg ctttcgctac ctggagagac gcgcccgctg atcctttgcg aatacgccca
     cgcgatgggt aacagtcttg gcggtttcgc taaatactgg caggcgtttc gtcagtatcc
     ccgtttacag ggcggcttcg tctgggactg ggtggatcag tcgctgatta aatatgatga
     aaacggcaac ccgtggtcgg cttacggcgg tgattttggc gatacgccga acgatcgcca
     gttctgtatg aacggtctgg tctttgccga ccgcacgccg catccagcgc tgacggaagc
     aaaacaccag cagcagtttt tccagttccg tttatccggg caaaccatcg aagtgaccag
     cgaatacctg ttccgtcata gcgataacga gctcctgcac tggatggtgg cgctggatgg
     taagccgctg gcaagcggtg aagtgcctct ggatgtcgct ccacaaggta aacagttgat
     tgaactgcct gaactaccgc agccggagag cgccgggcaa ctctggctca cagtacgcgt
     agtgcaaccg aacgcgaccg catggtcaga agccgggcac atcagcgcct ggcagcagtg
     gcgtctggcg gaaaacctca gtgtgacgct ccccgccgcg tcccacgcca tcccgcatct
     gaccaccagc gaaatggatt tttgcatcga gctgggtaat aagcgttggc aatttaaccg
     ccagtcaggc tttctttcac agatgtggat tggcgataaa aaacaactgc tgacgccgct
     gcgcgatcag ttcacccgtg caccgctgga taacgacatt ggcgtaagtg aagcgacccg
     cattgaccct aacgcctggg tcgaacgctg gaaggcggcg ggccattacc aggccgaagc
     agcgttgttg cagtgcacgg cagatacact tgctgatgcg gtgctgatta cgaccgctca
     cgcgtggcag catcagggga aaaccttatt tatcagccgg aaaacctacc ggattgatgg
     tagtggtcaa atggcgatta ccgttgatgt tgaagtggcg agcgatacac cgcatccggc
     gcggattggc ctgaactgcc agctggcgca ggtagcagag cgggtaaact ggctcggatt
     agggccgcaa gaaaactatc ccgaccgcct tactgccgcc tgttttgacc gctgggatct
     gccattgtca gacatgtata ccccgtacgt cttcccgagc gaaaacggtc tgcgctgcgg
     gacgcgcgaa ttgaattatg gcccacacca gtggcgcggc gacttccagt tcaacatcag
     ccgctacagt caacagcaac tgatggaaac cagccatcgc catctgctgc acgcggaaga
     aggcacatgg ctgaatatcg acggtttcca tatggggatt ggtggcgacg actcctggag
     cccgtcagta tcggcggaat tccagctgag cgccggtcgc taccattacc agttggtctg
     gtgtcaaaaa taataataac cgggcaggcc atgtctgccc gtatttcgcg taaggaaatc
     cattatgtac tatttcgcct gatgcggtat tttctcctta cgcatctgtg cggtatttca
     caccgcatag ggtaataact gatataatta aattgaagct ctaatttgtg agtttagtat
     acatgcattt acttataata cagtttttta gttttgctgg ccgcatcttc tcaaatatgc
     ttcccagcct gcttttctgt aacgttcacc ctctacctta gcatcccttc cctttgcaaa
     tagtcctctt ccaacaataa taatgtcaga tcctgtagag accacatcat ccacggttct
     atactgttga cccaatgcgt ctcccttgtc atctaaaccc acaccgggtg tcataatcaa
     ccaatcgtaa ccttcatctc ttccacccat gtctctttga gcaataaagc cgataacaaa
     atctttgtcg ctcttcgcaa tgtcaacagt acccttagta tattctccag tagataggga
     gcccttgcat gacaattctg ctaacatcaa aaggcctcta ggttcctttg ttacttcttc
     tgccgcctgc ttcaaaccgc taacaatacc tgggcccacc acaccgtgtg cattcgtaat
     gtctgcccat tctgctattc tgtatacacc cgcagagtac tgcaatttga ctgtattacc
     aatgtcagca aattttctgt cttcgaagag taaaaaattg tacttggcgg ataatgcctt
     tagcggctta actgtgccct ccatggaaaa atcagtcaag atatccacat gtgtttttag
     taaacaaatt ttgggaccta atgcttcaac taactccagt aattccttgg tggtacgaac
     atccaatgaa gcacacaagt ttgtttgctt ttcgtgcatg atattaaata gcttggcagc
     aacaggacta ggatgagtag cagcacgttc cttatatgta gctttcgaca tgatttatct
     tcgttttttg ttctgtgcag ttgggttaag aatactgggc aatttcatgt ttcttcaaca
     ctacatatgc gtatatatac caatctaagt ctgtgctcct tccttcgttc ttccttctgt
     tcggagatta ccgaatcaaa aaaatttcaa agaaaccgaa atcaaaaaaa agaataaaaa
     aaaaatgatg aattgaattg aaaagctact tgttacccat cattgaattt tgaacatccg
     aacctgggag ttttccctga aacagatagt atatttgaac ctgtataata atatatagtc
     tagcgcttta cggaagacaa tgtatgtatt tcggttcctg gagaaactat tgcatctatt
     gcataggtaa tcttgcacgt cgcatccccg gttcattttc tgcgtttcca tcttgcactt
     caatagcata tctttgttaa cgaagcatct gtgcttcatt ttgtagaaca aaaatgcaac
     gcgagagcgc taatttttca aacaaagaat ctgagctgca tttttacaga acagaaatgc
     aacgcgaaag cgctatttta ccaacgaaga atctgtgctt catttttgta aaacaaaaat
     gcaacgcgag agcgctaatt tttcaaacaa agaatctgag ctgcattttt acagaacaga
     aatgcaacgc gagagcgcta ttttaccaac aaagaatcta tacttctttt ttgttctaca
     aaaatgcatc ccgagagcgc tatttttcta acaaagcatc ttagattact ttttttctcc
     tttgtgcgct ctataatgca gtctcttgat aactttttgc actgtaggtc cgttaaggtt
     agaagaaggc tactttggtg tctattttct cttccataaa aaaagcctga ctccacttcc
     cgcgtttact gattactagc gaagctgcgg gtgcattttt tcaagataaa ggcatccccg
     attatattct ataccgatgt ggattgcgca tactttgtga acagaaagtg atagcgttga
     tgattcttca ttggtcagaa aattatgaac ggtttcttct attttgtctc tatatactac
     gtataggaaa tgtttacatt ttcgtattgt tttcgattca ctctatgaat agttcttact
     acaatttttt tgtctaaaga gtaatactag agataaacat aaaaaatgta gaggtcgagt
     ttagatgcaa gttcaaggag cgaaaggtgg atgggtaggt tatataggga tatagcacag
     agatatatag caaagagata cttttgagca atgtttgtgg aagcggtatt cgcaatattt
     tagtagctcg ttacagtccg gtgcgttttt ggttttttga aagtgcgtct tcagagcgct
     tttggttttc aaaagcgctc tgaagttcct atactttcta gctagagaat aggaacttcg
     gaataggaac ttcaaagcgt ttccgaaaac gagcgcttcc gaaaatgcaa cgcgagctgc
     gcacatacag ctcactgttc acgtcgcacc tatatctgcg tgttgcctgt atatatatat
     acatgagaag aacggcatag tgcgtgttta tgcttaaatg cgttatggtg cactctcagt
     acaatctgct ctgatgccgc atagttaagc cagccccgac acccgccaac acccgctgac
     gcgccctgac gggcttgtct gctcccggca tccgcttaca gacaagctgt gaccgtctcc
     gggagctgca tgtgtcagag gttttcaccg tcatcaccga aacgcgcgag acgaaagggc
     ctcgtgatac gcctattttt ataggttaat gtcatgataa taatggtttc ttagacgtca
     ggtggcactt ttcggggaaa tgtgcgcgga acccctattt gtttattttt ctaaatacat
     tcaaatatgt atccgctcat gagacaataa ccctgataaa tgcttcaata atattgaaaa
     aggaagagta tgagtattca acatttccgt gtcgccctta ttcccttttt tgcggcattt
     tgccttcctg tttttgctca cccagaaacg ctggtgaaag taaaagatgc tgaagatcag
     ttgggtgcac gagtgggtta catcgaactg gatctcaaca gcggtaagat ccttgagagt
     tttcgccccg aagaacgttt tccaatgatg agcactttta aagttctgct atgtggcgcg
     gtattatccc gtattgacgc cgggcaagag caactcggtc gccgcataca ctattctcag
     aatgacttgg ttgagtactc accagtcaca gaaaagcatc ttacggatgg catgacagta
     agagaattat gcagtgctgc cataaccatg agtgataaca ctgcggccaa cttacttctg
     acaacgatcg gaggaccgaa ggagctaacc gcttttttgc acaacatggg ggatcatgta
     actcgccttg atcgttggga accggagctg aatgaagcca taccaaacga cgagcgtgac
     accacgatgc ctgtagcaat ggcaacaacg ttgcgcaaac tattaactgg cgaactactt
     actctagctt cccggcaaca attaatagac tggatggagg cggataaagt tgcaggacca
     cttctgcgct cggcccttcc ggctggctgg tttattgctg ataaatctgg agccggtgag
     cgtgggtctc gcggtatcat tgcagcactg gggccagatg gtaagccctc ccgtatcgta
     gttatctaca cgacggggag tcaggcaact atggatgaac gaaatagaca gatcgctgag
     ataggtgcct cactgattaa gcattggtaa ctgtcagacc aagtttactc atatatactt
     tagattgatt taaaacttca tttttaattt aaaaggatct aggtgaagat cctttttgat
     aatctcatga ccaaaatccc ttaacgtgag ttttcgttcc actgagcgtc agaccccgta
     gaaaagatca aaggatcttc ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa
     acaaaaaaac caccgctacc agcggtggtt tgtttgccgg atcaagagct accaactctt
     tttccgaagg taactggctt cagcagagcg cagataccaa atactgtcct tctagtgtag
     ccgtagttag gccaccactt caagaactct gtagcaccgc ctacatacct cgctctgcta
     atcctgttac cagtggctgc tgccagtggc gataagtcgt gtcttaccgg gttggactca
     agacgatagt taccggataa ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag
     cccagcttgg agcgaacgac ctacaccgaa ctgagatacc tacagcgtga gcattgagaa
     agcgccacgc ttcccgaagg gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga
     acaggagagc gcacgaggga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc
     gggtttcgcc acctctgact tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc
     ctatggaaaa acgccagcaa cgcggccttt ttacggttcc tggccttttg ctggcctttt
     gctcacatgt tctttcctgc gttatcccct gattctgtgg ataaccgtat taccgccttt
     gagtgagctg ataccgctcg ccgcagccga acgaccgagc gcagcgagtc agtgagcgag
     gaagcggaag agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattcc
     cg
//