back Return to this vector's summary.
ID   YIP356R    preliminary; circular DNA; SYN; 7086 BP.
AC   ATCC37755;
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
DE   Saccharomyces/E.coli plasmid vector YIp356R - complete.
KW   cloning vector.
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
RN   [1]
RC   YEp352E from YEp352 & linker
RC   YEp363A from pNM480 & YEp351
RC   YEp353A from pNM480 & YEp352
RC   YEp353 from YEp353A & YEp352E
RC   YEp354A from pNM481 & YEp352
RC   YEp354 from YEp354A & YEp352E
RC   YEp355A from pNM482 & YEp352
RC   YEp355 from YEp355A & YEp352E
RC   YEp356, YEp356R from YEp353 & pUC18
RC   YEp357, YEp357R from YEp354 & pUC18
RC   YEp358, YEp358R from YEp355 & pUC18
RC   YEp363 from YEp363A & YEp353
RC   YEp364 from YEp363A & YEp354
RC   YEp365 from YEp363A & YEp355
RC   YEp366 from YEp363A & YEp356
RC   YEp367 from YEp363A & YEp357
RC   YEp368 from YEp363A & YEp358
RC   YEp366R from YEp363A & YEp356R
RC   YEp367R from YEp363A & YEp357R
RC   YEp368R from YEp363A & YEp358R
RC   YIp353 from YEp353 & YIp352
RC   YIp354 from YEp354 & YIp352
RC   YIp355 from YEp355 & YIp352
RC   YIp356 from YEp356 & YIp352
RC   YIp357 from YEp357 & YIp352
RC   YIp358 from YEp358 & YIp352
RC   YIp356R from YEp356R & YIp352
RC   YIp357R from YEp357R & YIp352
RC   YIp358R from YEp358R & YIp352
RC   YIp363 from YEp363 & YIp351
RC   YIp364 from YEp364 & YIp351
RC   YIp365 from YEp365 & YIp351
RC   YIp366 from YEp366 & YIp351
RC   YIp367 from YEp367 & YIp351
RC   YIp368 from YEp368 & YIp351
RC   YIp366R from YEp366R & YIp351
RC   YIp367R from YEp367R & YIp351
RC   YIp368R from YEp368R & YIp351
RA   Myers A.M., Tzagoloff A., Kinney D.M., Lusty C.J.;
RT   "Yeast shuttle and integrative vectors with multiple cloning sites
RT   suitable for construction of lacZ fusions";
RL   Gene 45:299-310(1986).
CC   Created by Moore, July 1995, under contract with NCBI.
CC   Restriction digests of the clone give the following sizes (kb):
CC   EcoRI--7.1; SalI--7.1; PstI--7.1; HindIII--7.1. (ATCC staff)
CC   The sequence and reading frame of the multiple cloning sequence is:
CC   GAA TTC CCA GCT TGC GAT CCC3', from nucleotide 1 of MCS through CCC
CC   for amino acid 8 of beta-galactosidase.
CC   One of 3 promoter-cloning, YI type shuttle vectors (ATCC 37755 to
CC   ATCC 37757) with URA3 selection in Saccharomyces cerevisiae, a
CC   beta-galactosidase reporter gene and multiple cloning sites differing
CC   in reading frame.
CC   The cleavage position in the reading frame for cloning sites is (where
CC   3 = between triplets): HindIII-1; SphI-2; PstI-2; SalI-1; XbaI-1;
CC   BamHI-1; SmaI-2; KpnI-2; SacI-2; EcoRI-1. The SacI site is not unique.
CC   Medium is 1227 LB plus ampicillin.
CC   NM (YIp356R)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   HO (E.coli HB101)(Saccharomyces cerevisiae)(E.coli)(E.coli MC1061)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (YEp353)(YIp352)
CC   BR ()
CC   OF ()
CC   OR ()
FH   Key             Location/Qualifiers
FT   misc_feature    0..0
FT                   /note="1. YEp356R AatII-NcoI 5867bp 5961..7944..3884
FT                   2. YIp352 NcoI-AatII 1198bp 958..2156, URA3/pUC18
FT                   -> YIp356R 7065bp"
FT   -               1..1985
FT                   /note="YEp353 5961..7944..1 1985bp
FT                   EcoRI = G^AATTC
FT                   \         aattc..."
FT   -               1986..2036
FT                   /note="51bp
FT                   \ aattcgagctcggtacccggggatcctctagagtcgacctgcaggcatgca
FT                   \  ...atgca
FT                   HindIII = A^AGCTT"
FT   -               2037..5888
FT                   /note="YEp353 32..3883 3852bp
FT                   NcoI = C^CATGG"
FT   -               5889..7086
FT                   /note="YIp352 958..2155 1198bp
FT                   AatII = GACGT^C"
FT   misc_binding    0..0
FT                   /note="MCS HindIII-SphI-PstI-SalI-XbaI-BamHI-SmaI-
FT                   KpnI-SacI-EcoRI"
FT   misc_binding    0..0
FT                   /note="SIT unique HindIII-SphI-PstI-SalI-XbaI-BamHI-
FT                   SmaI-KpnI-EcoRI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   CDS             0..0
FT                   /note="ANT yeast URA3 gene"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ);
FT                   reporter gene"
SQ   Sequence 7086 BP; 1709 A; 1809 C; 1774 G; 1794 T; 0 other;
     caggtggcac ttttcgggga aatgtgcgcg gaacccctat ttgtttattt ttctaaatac
     attcaaatat gtatccgctc atgagacaat aaccctgata aatgcttcaa taatattgaa
     aaaggaagag tatgagtatt caacatttcc gtgtcgccct tattcccttt tttgcggcat
     tttgccttcc tgtttttgct cacccagaaa cgctggtgaa agtaaaagat gctgaagatc
     agttgggtgc acgagtgggt tacatcgaac tggatctcaa cagcggtaag atccttgaga
     gttttcgccc cgaagaacgt tttccaatga tgagcacttt taaagttctg ctatgtggcg
     cggtattatc ccgtattgac gccgggcaag agcaactcgg tcgccgcata cactattctc
     agaatgactt ggttgagtac tcaccagtca cagaaaagca tcttacggat ggcatgacag
     taagagaatt atgcagtgct gccataacca tgagtgataa cactgcggcc aacttacttc
     tgacaacgat cggaggaccg aaggagctaa ccgctttttt gcacaacatg ggggatcatg
     taactcgcct tgatcgttgg gaaccggagc tgaatgaagc cataccaaac gacgagcgtg
     acaccacgat gcctgtagca atggcaacaa cgttgcgcaa actattaact ggcgaactac
     ttactctagc ttcccggcaa caattaatag actggatgga ggcggataaa gttgcaggac
     cacttctgcg ctcggccctt ccggctggct ggtttattgc tgataaatct ggagccggtg
     agcgtgggtc tcgcggtatc attgcagcac tggggccaga tggtaagccc tcccgtatcg
     tagttatcta cacgacgggg agtcaggcaa ctatggatga acgaaataga cagatcgctg
     agataggtgc ctcactgatt aagcattggt aactgtcaga ccaagtttac tcatatatac
     tttagattga tttaaaactt catttttaat ttaaaaggat ctaggtgaag atcctttttg
     ataatctcat gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg tcagaccccg
     tagaaaagat caaaggatct tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc
     aaacaaaaaa accaccgcta ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc
     tttttccgaa ggtaactggc ttcagcagag cgcagatacc aaatactgtc cttctagtgt
     agccgtagtt aggccaccac ttcaagaact ctgtagcacc gcctacatac ctcgctctgc
     taatcctgtt accagtggct gctgccagtg gcgataagtc gtgtcttacc gggttggact
     caagacgata gttaccggat aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac
     agcccagctt ggagcgaacg acctacaccg aactgagata cctacagcgt gagcattgag
     aaagcgccac gcttcccgaa gggagaaagg cggacaggta tccggtaagc ggcagggtcg
     gaacaggaga gcgcacgagg gagcttccag ggggaaacgc ctggtatctt tatagtcctg
     tcgggtttcg ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga
     gcctatggaa aaacgccagc aacgcggcct ttttacggtt cctggccttt tgctggcctt
     ttgctcacat gttctttcct gcgttatccc ctgattctgt ggataaccgt attaccgcct
     ttgagtgagc tgataccgct cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg
     aggaagcgga agagcgccca atacgcaaac cgcctctccc cgcgcgttgg ccgattcatt
     cccggaattc gagctcggta cccggggatc ctctagagtc gacctgcagg catgcaagct
     tgcgatcccg ccgtcgtttt acaacgtcgt gactgggaaa accctggcgt tacccaactt
     aatcgccttg cagcacatcc ccctttcgcc agctggcgta atagcgaaga ggcccgcacc
     gatcgccctt cccaacagtt gcgcagcctg aatggcgaat ggcgctttgc ctggtttccg
     gcaccagaag cggtgccgga aagctggctg gagtgcgatc ttcctgaggc cgatactgtc
     gtcgtcccct caaactggca gatgcacggt tacgatgcgc ccatctacac caacgtaacc
     tatcccatta cggtcaatcc gccgtttgtt cccacggaga atccgacggg ttgttactcg
     ctcacattta atgttgatga aagctggcta caggaaggcc agacgcgaat tatttttgat
     ggcgttaact cggcgtttca tctgtggtgc aacgggcgct gggtcggtta cggccaggac
     agtcgtttgc cgtctgaatt tgacctgagc gcatttttac gcgccggaga aaaccgcctc
     gcggtgatgg tgctgcgttg gagtgacggc agttatctgg aagatcagga tatgtggcgg
     atgagcggca ttttccgtga cgtctcgttg ctgcataaac cgactacaca aatcagcgat
     ttccatgttg ccactcgctt taatgatgat ttcagccgcg ctgtactgga ggctgaagtt
     cagatgtgcg gcgagttgcg tgactaccta cgggtaacag tttctttatg gcagggtgaa
     acgcaggtcg ccagcggcac cgcgcctttc ggcggtgaaa ttatcgatga gcgtggtggt
     tatgccgatc gcgtcacact acgtctgaac gtcgaaaacc cgaaactgtg gagcgccgaa
     atcccgaatc tctatcgtgc ggtggttgaa ctgcacaccg ccgacggcac gctgattgaa
     gcagaagcct gcgatgtcgg tttccgcgag gtgcggattg aaaatggtct gctgctgctg
     aacggcaagc cgttgctgat tcgaggcgtt aaccgtcacg agcatcatcc tctgcatggt
     caggtcatgg atgagcagac gatggtgcag gatatcctgc tgatgaagca gaacaacttt
     aacgccgtgc gctgttcgca ttatccgaac catccgctgt ggtacacgct gtgcgaccgc
     tacggcctgt atgtggtgga tgaagccaat attgaaaccc acggcatggt gccaatgaat
     cgtctgaccg atgatccgcg ctggctaccg gcgatgagcg aacgcgtaac gcgaatggtg
     cagcgcgatc gtaatcaccc gagtgtgatc atctggtcgc tggggaatga atcaggccac
     ggcgctaatc acgacgcgct gtatcgctgg atcaaatctg tcgatccttc ccgcccggtg
     cagtatgaag gcggcggagc cgacaccacg gccaccgata ttatttgccc gatgtacgcg
     cgcgtggatg aagaccagcc cttcccggct gtgccgaaat ggtccatcaa aaaatggctt
     tcgctacctg gagagacgcg cccgctgatc ctttgcgaat acgcccacgc gatgggtaac
     agtcttggcg gtttcgctaa atactggcag gcgtttcgtc agtatccccg tttacagggc
     ggcttcgtct gggactgggt ggatcagtcg ctgattaaat atgatgaaaa cggcaacccg
     tggtcggctt acggcggtga ttttggcgat acgccgaacg atcgccagtt ctgtatgaac
     ggtctggtct ttgccgaccg cacgccgcat ccagcgctga cggaagcaaa acaccagcag
     cagtttttcc agttccgttt atccgggcaa accatcgaag tgaccagcga atacctgttc
     cgtcatagcg ataacgagct cctgcactgg atggtggcgc tggatggtaa gccgctggca
     agcggtgaag tgcctctgga tgtcgctcca caaggtaaac agttgattga actgcctgaa
     ctaccgcagc cggagagcgc cgggcaactc tggctcacag tacgcgtagt gcaaccgaac
     gcgaccgcat ggtcagaagc cgggcacatc agcgcctggc agcagtggcg tctggcggaa
     aacctcagtg tgacgctccc cgccgcgtcc cacgccatcc cgcatctgac caccagcgaa
     atggattttt gcatcgagct gggtaataag cgttggcaat ttaaccgcca gtcaggcttt
     ctttcacaga tgtggattgg cgataaaaaa caactgctga cgccgctgcg cgatcagttc
     acccgtgcac cgctggataa cgacattggc gtaagtgaag cgacccgcat tgaccctaac
     gcctgggtcg aacgctggaa ggcggcgggc cattaccagg ccgaagcagc gttgttgcag
     tgcacggcag atacacttgc tgatgcggtg ctgattacga ccgctcacgc gtggcagcat
     caggggaaaa ccttatttat cagccggaaa acctaccgga ttgatggtag tggtcaaatg
     gcgattaccg ttgatgttga agtggcgagc gatacaccgc atccggcgcg gattggcctg
     aactgccagc tggcgcaggt agcagagcgg gtaaactggc tcggattagg gccgcaagaa
     aactatcccg accgccttac tgccgcctgt tttgaccgct gggatctgcc attgtcagac
     atgtataccc cgtacgtctt cccgagcgaa aacggtctgc gctgcgggac gcgcgaattg
     aattatggcc cacaccagtg gcgcggcgac ttccagttca acatcagccg ctacagtcaa
     cagcaactga tggaaaccag ccatcgccat ctgctgcacg cggaagaagg cacatggctg
     aatatcgacg gtttccatat ggggattggt ggcgacgact cctggagccc gtcagtatcg
     gcggaattcc agctgagcgc cggtcgctac cattaccagt tggtctggtg tcaaaaataa
     taataaccgg gcaggccatg tctgcccgta tttcgcgtaa ggaaatccat tatgtactat
     ttcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac cgcatagggt
     aataactgat ataattaaat tgaagctcta atttgtgagt ttagtataca tgcatttact
     tataatacag ttttttagtt ttgctggccg catcttctca aatatgcttc ccagcctgct
     tttctgtaac gttcaccctc taccttagca tcccttccct ttgcaaatag tcctcttcca
     acaataataa tgtcagatcc tgtagagacc acatcatcca cggttctata ctgttgaccc
     aatgcgtctc ccttgtcatc taaacccaca ccgggtgtca taatcaacca atcgtaacct
     tcatctcttc cacccatgtc tctttgagca ataaagccga taacaaaatc tttgtcgctc
     ttcgcaatgt caacagtacc cttagtatat tctccagtag atagggagcc cttgcatgac
     aattctgcta acatcaaaag gcctctaggt tcctttgtta cttcttctgc cgcctgcttc
     aaaccgctaa caatacctgg gcccaccaca ccgtgtgcat tcgtaatgtc tgcccattct
     gctattctgt atacacccgc agagtactgc aatttgactg tattaccaat gtcagcaaat
     tttctgtctt cgaagagtaa aaaattgtac ttggcggata atgcctttag cggcttaact
     gtgccctcca tggaaaaatc agtcaagata tccacatgtg tttttagtaa acaaattttg
     ggacctaatg cttcaactaa ctccagtaat tccttggtgg tacgaacatc caatgaagca
     cacaagtttg tttgcttttc gtgcatgata ttaaatagct tggcagcaac aggactagga
     tgagtagcag cacgttcctt atatgtagct ttcgacatga tttatcttcg tttcggtttt
     tgttctgtgc agttgggtta agaatactgg gcaatttcat gtttcttcaa cactacatat
     gcgtatatat accaatctaa gtctgtgctc cttccttcgt tcttccttct gttcggagat
     taccgaatca aaaaaatttc aaagaaaccg aaatcaaaaa aaagaataaa aaaaaaatga
     tgaattgaaa agctcttgtt acccatcatt gaattttgaa catccgaacc tgggagtttt
     ccctgaaaca gatagtatat ttgaacctgt ataataatat atagtctagc gctttacgga
     agacaatgta tgtatttcgg ttcctggaga aactattgca tctattgcat aggtaatctt
     gcacgtcgca tccccggttc attttctgcg tttccatctt gcacttcaat agcatatctt
     tgttatttta gtagctcgtt acagtccggt gcgtttttgg ttttttgaaa gtgcgtcttc
     agagcgcttt tggttttcaa aagcgctctg aagttcctat actttctagc tagagaatag
     gaacttcgga ataggaactt caaagcgttt ccgaaaacga gcgcttccga aaatgcaacg
     cgagctgcgc acatacagct cactgttcac gtcgcaccta tatctgcgtg ttgcctgtat
     atatatatac atgagaagaa cggcatagtg cgtgtttatg cttaaatgcg ttatggtgca
     ctctcagtac aatctgctct gatgccgcat agttaagcca gccccgacac ccgccaacac
     ccgctgacgc gccctgacgg gcttgtctgc tcccggcatc cgcttacaga caagctgtga
     ccgtctccgg gagctgcatg tgtcagaggt tttcaccgtc atcaccgaaa cgcgcgagac
     gaaagggcct cgtgatacgc ctatttttat aggttaatgt catgataata atggtttctt