back Return to this vector's summary.
ID   YIP357     preliminary; circular DNA; SYN; 7084 BP.
XX
AC   ATCC37750;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli plasmid vector YIp357 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   YEp352E from YEp352 & linker
RC   YEp363A from pNM480 & YEp351
RC   YEp353A from pNM480 & YEp352
RC   YEp353 from YEp353A & YEp352E
RC   YEp354A from pNM481 & YEp352
RC   YEp354 from YEp354A & YEp352E
RC   YEp355A from pNM482 & YEp352
RC   YEp355 from YEp355A & YEp352E
RC   YEp356, YEp356R from YEp353 & pUC18
RC   YEp357, YEp357R from YEp354 & pUC18
RC   YEp358, YEp358R from YEp355 & pUC18
RC   YEp363 from YEp363A & YEp353
RC   YEp364 from YEp363A & YEp354
RC   YEp365 from YEp363A & YEp355
RC   YEp366 from YEp363A & YEp356
RC   YEp367 from YEp363A & YEp357
RC   YEp368 from YEp363A & YEp358
RC   YEp366R from YEp363A & YEp356R
RC   YEp367R from YEp363A & YEp357R
RC   YEp368R from YEp363A & YEp358R
RC   YIp353 from YEp353 & YIp352
RC   YIp354 from YEp354 & YIp352
RC   YIp355 from YEp355 & YIp352
RC   YIp356 from YEp356 & YIp352
RC   YIp357 from YEp357 & YIp352
RC   YIp358 from YEp358 & YIp352
RC   YIp356R from YEp356R & YIp352
RC   YIp357R from YEp357R & YIp352
RC   YIp358R from YEp358R & YIp352
RC   YIp363 from YEp363 & YIp351
RC   YIp364 from YEp364 & YIp351
RC   YIp365 from YEp365 & YIp351
RC   YIp366 from YEp366 & YIp351
RC   YIp367 from YEp367 & YIp351
RC   YIp368 from YEp368 & YIp351
RC   YIp366R from YEp366R & YIp351
RC   YIp367R from YEp367R & YIp351
RC   YIp368R from YEp368R & YIp351
RA   Myers A.M., Tzagoloff A., Kinney D.M., Lusty C.J.;
RT   "Yeast shuttle and integrative vectors with multiple cloning sites
RT   suitable for construction of lacZ fusions";
RL   Gene 45:299-310(1986).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   The sequence and reading frame of the multiple cloning sequence is:
CC   5' GAA TTC GAG CTC GGT ACC CGG GGA TCC TCT AGA GTC GAC CTG CAG GCA TGC
CC   AAG CTT GCT CCC 3', from nucleotide 1 of the MCS through CCC for amino
CC   acid 8 of beta-galactosidase.
CC   One of 3 promoter-cloning, YI type shuttle vectors (ATCC 37749 to
CC   ATCC 37751) with URA3 selection in Saccharomyces cerevisiae, a
CC   beta-galactosidase reporter gene and multiple cloning sites differing
CC   in reading frame.
CC   The cleavage position in the reading frame for cloning sites is (where
CC   3 = between triplets): EcoRI-1; SacI-2; KpnI-2; SmaI-1; BamHI-1;
CC   XbaI-1; SalI-1; PstI-2; SphI-2; HindIII-1. The SacI site is not
CC   unique.
CC   Restriction digests of the clone give the following sizes (kb):
CC   EcoRI--7.1; SalI--7.1; HindIII--7.1. (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (YIp357)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli HB101)(Saccharomyces cerevisiae)(E.coli)(E.coli MC1061)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (YEp353)(YIp352)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. YEp357 AatII-NcoI 5867bp 5961..7944..3884
FT                   2. YIp352 NcoI-AatII 1198bp 958..2156, URA3/pUC18
FT                   -> YIp357 7065bp"
FT   -               1..1985
FT                   /note="YEp353 5961..7944..1 1985bp
FT                   EcoRI = G^AATTC
FT                   \         aattc..."
FT   -               1986..2036
FT                   /note="51bp
FT                   \ aattcgagctcggtacccggggatcctctagagtcgacctgcaggcatgca
FT                   \  ...atgca
FT                   HindIII = A^AGCTT"
FT   -               2037..2043
FT                   /note="YEp353 32..38 7bp"
FT   -               2044..5886
FT                   /note="YEp353 41..3883 3843bp
FT                   NcoI = C^CATGG"
FT   -               5887..7084
FT                   /note="YIp352 958..2155 1198bp
FT                   AatII = GACGT^C"
FT   misc_binding    0..0
FT                   /note="MCS EcoRI-SacI-KpnI-SmaI-BamHI-XbaI-SalI-PstI-
FT                   SphI-HindIII"
FT   misc_binding    0..0
FT                   /note="SIT unique EcoRI-KpnI-SmaI-BamHI-XbaI-SalI-
FT                   PstI-SphI-HindIII"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   CDS             0..0
FT                   /note="ANT yeast URA3 gene"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ);
FT                   reporter gene"
XX
SQ   Sequence 7084 BP; 1708 A; 1809 C; 1773 G; 1794 T; 0 other;
     caggtggcac ttttcgggga aatgtgcgcg gaacccctat ttgtttattt ttctaaatac
     attcaaatat gtatccgctc atgagacaat aaccctgata aatgcttcaa taatattgaa
     aaaggaagag tatgagtatt caacatttcc gtgtcgccct tattcccttt tttgcggcat
     tttgccttcc tgtttttgct cacccagaaa cgctggtgaa agtaaaagat gctgaagatc
     agttgggtgc acgagtgggt tacatcgaac tggatctcaa cagcggtaag atccttgaga
     gttttcgccc cgaagaacgt tttccaatga tgagcacttt taaagttctg ctatgtggcg
     cggtattatc ccgtattgac gccgggcaag agcaactcgg tcgccgcata cactattctc
     agaatgactt ggttgagtac tcaccagtca cagaaaagca tcttacggat ggcatgacag
     taagagaatt atgcagtgct gccataacca tgagtgataa cactgcggcc aacttacttc
     tgacaacgat cggaggaccg aaggagctaa ccgctttttt gcacaacatg ggggatcatg
     taactcgcct tgatcgttgg gaaccggagc tgaatgaagc cataccaaac gacgagcgtg
     acaccacgat gcctgtagca atggcaacaa cgttgcgcaa actattaact ggcgaactac
     ttactctagc ttcccggcaa caattaatag actggatgga ggcggataaa gttgcaggac
     cacttctgcg ctcggccctt ccggctggct ggtttattgc tgataaatct ggagccggtg
     agcgtgggtc tcgcggtatc attgcagcac tggggccaga tggtaagccc tcccgtatcg
     tagttatcta cacgacgggg agtcaggcaa ctatggatga acgaaataga cagatcgctg
     agataggtgc ctcactgatt aagcattggt aactgtcaga ccaagtttac tcatatatac
     tttagattga tttaaaactt catttttaat ttaaaaggat ctaggtgaag atcctttttg
     ataatctcat gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg tcagaccccg
     tagaaaagat caaaggatct tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc
     aaacaaaaaa accaccgcta ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc
     tttttccgaa ggtaactggc ttcagcagag cgcagatacc aaatactgtc cttctagtgt
     agccgtagtt aggccaccac ttcaagaact ctgtagcacc gcctacatac ctcgctctgc
     taatcctgtt accagtggct gctgccagtg gcgataagtc gtgtcttacc gggttggact
     caagacgata gttaccggat aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac
     agcccagctt ggagcgaacg acctacaccg aactgagata cctacagcgt gagcattgag
     aaagcgccac gcttcccgaa gggagaaagg cggacaggta tccggtaagc ggcagggtcg
     gaacaggaga gcgcacgagg gagcttccag ggggaaacgc ctggtatctt tatagtcctg
     tcgggtttcg ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga
     gcctatggaa aaacgccagc aacgcggcct ttttacggtt cctggccttt tgctggcctt
     ttgctcacat gttctttcct gcgttatccc ctgattctgt ggataaccgt attaccgcct
     ttgagtgagc tgataccgct cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg
     aggaagcgga agagcgccca atacgcaaac cgcctctccc cgcgcgttgg ccgattcatt
     cccggaattc gagctcggta cccggggatc ctctagagtc gacctgcagg catgcaagct
     tgctcccgcc gtcgttttac aacgtcgtga ctgggaaaac cctggcgtta cccaacttaa
     tcgccttgca gcacatcccc ctttcgccag ctggcgtaat agcgaagagg cccgcaccga
     tcgcccttcc caacagttgc gcagcctgaa tggcgaatgg cgctttgcct ggtttccggc
     accagaagcg gtgccggaaa gctggctgga gtgcgatctt cctgaggccg atactgtcgt
     cgtcccctca aactggcaga tgcacggtta cgatgcgccc atctacacca acgtaaccta
     tcccattacg gtcaatccgc cgtttgttcc cacggagaat ccgacgggtt gttactcgct
     cacatttaat gttgatgaaa gctggctaca ggaaggccag acgcgaatta tttttgatgg
     cgttaactcg gcgtttcatc tgtggtgcaa cgggcgctgg gtcggttacg gccaggacag
     tcgtttgccg tctgaatttg acctgagcgc atttttacgc gccggagaaa accgcctcgc
     ggtgatggtg ctgcgttgga gtgacggcag ttatctggaa gatcaggata tgtggcggat
     gagcggcatt ttccgtgacg tctcgttgct gcataaaccg actacacaaa tcagcgattt
     ccatgttgcc actcgcttta atgatgattt cagccgcgct gtactggagg ctgaagttca
     gatgtgcggc gagttgcgtg actacctacg ggtaacagtt tctttatggc agggtgaaac
     gcaggtcgcc agcggcaccg cgcctttcgg cggtgaaatt atcgatgagc gtggtggtta
     tgccgatcgc gtcacactac gtctgaacgt cgaaaacccg aaactgtgga gcgccgaaat
     cccgaatctc tatcgtgcgg tggttgaact gcacaccgcc gacggcacgc tgattgaagc
     agaagcctgc gatgtcggtt tccgcgaggt gcggattgaa aatggtctgc tgctgctgaa
     cggcaagccg ttgctgattc gaggcgttaa ccgtcacgag catcatcctc tgcatggtca
     ggtcatggat gagcagacga tggtgcagga tatcctgctg atgaagcaga acaactttaa
     cgccgtgcgc tgttcgcatt atccgaacca tccgctgtgg tacacgctgt gcgaccgcta
     cggcctgtat gtggtggatg aagccaatat tgaaacccac ggcatggtgc caatgaatcg
     tctgaccgat gatccgcgct ggctaccggc gatgagcgaa cgcgtaacgc gaatggtgca
     gcgcgatcgt aatcacccga gtgtgatcat ctggtcgctg gggaatgaat caggccacgg
     cgctaatcac gacgcgctgt atcgctggat caaatctgtc gatccttccc gcccggtgca
     gtatgaaggc ggcggagccg acaccacggc caccgatatt atttgcccga tgtacgcgcg
     cgtggatgaa gaccagccct tcccggctgt gccgaaatgg tccatcaaaa aatggctttc
     gctacctgga gagacgcgcc cgctgatcct ttgcgaatac gcccacgcga tgggtaacag
     tcttggcggt ttcgctaaat actggcaggc gtttcgtcag tatccccgtt tacagggcgg
     cttcgtctgg gactgggtgg atcagtcgct gattaaatat gatgaaaacg gcaacccgtg
     gtcggcttac ggcggtgatt ttggcgatac gccgaacgat cgccagttct gtatgaacgg
     tctggtcttt gccgaccgca cgccgcatcc agcgctgacg gaagcaaaac accagcagca
     gtttttccag ttccgtttat ccgggcaaac catcgaagtg accagcgaat acctgttccg
     tcatagcgat aacgagctcc tgcactggat ggtggcgctg gatggtaagc cgctggcaag
     cggtgaagtg cctctggatg tcgctccaca aggtaaacag ttgattgaac tgcctgaact
     accgcagccg gagagcgccg ggcaactctg gctcacagta cgcgtagtgc aaccgaacgc
     gaccgcatgg tcagaagccg ggcacatcag cgcctggcag cagtggcgtc tggcggaaaa
     cctcagtgtg acgctccccg ccgcgtccca cgccatcccg catctgacca ccagcgaaat
     ggatttttgc atcgagctgg gtaataagcg ttggcaattt aaccgccagt caggctttct
     ttcacagatg tggattggcg ataaaaaaca actgctgacg ccgctgcgcg atcagttcac
     ccgtgcaccg ctggataacg acattggcgt aagtgaagcg acccgcattg accctaacgc
     ctgggtcgaa cgctggaagg cggcgggcca ttaccaggcc gaagcagcgt tgttgcagtg
     cacggcagat acacttgctg atgcggtgct gattacgacc gctcacgcgt ggcagcatca
     ggggaaaacc ttatttatca gccggaaaac ctaccggatt gatggtagtg gtcaaatggc
     gattaccgtt gatgttgaag tggcgagcga tacaccgcat ccggcgcgga ttggcctgaa
     ctgccagctg gcgcaggtag cagagcgggt aaactggctc ggattagggc cgcaagaaaa
     ctatcccgac cgccttactg ccgcctgttt tgaccgctgg gatctgccat tgtcagacat
     gtataccccg tacgtcttcc cgagcgaaaa cggtctgcgc tgcgggacgc gcgaattgaa
     ttatggccca caccagtggc gcggcgactt ccagttcaac atcagccgct acagtcaaca
     gcaactgatg gaaaccagcc atcgccatct gctgcacgcg gaagaaggca catggctgaa
     tatcgacggt ttccatatgg ggattggtgg cgacgactcc tggagcccgt cagtatcggc
     ggaattccag ctgagcgccg gtcgctacca ttaccagttg gtctggtgtc aaaaataata
     ataaccgggc aggccatgtc tgcccgtatt tcgcgtaagg aaatccatta tgtactattt
     cgcctgatgc ggtattttct ccttacgcat ctgtgcggta tttcacaccg catagggtaa
     taactgatat aattaaattg aagctctaat ttgtgagttt agtatacatg catttactta
     taatacagtt ttttagtttt gctggccgca tcttctcaaa tatgcttccc agcctgcttt
     tctgtaacgt tcaccctcta ccttagcatc ccttcccttt gcaaatagtc ctcttccaac
     aataataatg tcagatcctg tagagaccac atcatccacg gttctatact gttgacccaa
     tgcgtctccc ttgtcatcta aacccacacc gggtgtcata atcaaccaat cgtaaccttc
     atctcttcca cccatgtctc tttgagcaat aaagccgata acaaaatctt tgtcgctctt
     cgcaatgtca acagtaccct tagtatattc tccagtagat agggagccct tgcatgacaa
     ttctgctaac atcaaaaggc ctctaggttc ctttgttact tcttctgccg cctgcttcaa
     accgctaaca atacctgggc ccaccacacc gtgtgcattc gtaatgtctg cccattctgc
     tattctgtat acacccgcag agtactgcaa tttgactgta ttaccaatgt cagcaaattt
     tctgtcttcg aagagtaaaa aattgtactt ggcggataat gcctttagcg gcttaactgt
     gccctccatg gaaaaatcag tcaagatatc cacatgtgtt tttagtaaac aaattttggg
     acctaatgct tcaactaact ccagtaattc cttggtggta cgaacatcca atgaagcaca
     caagtttgtt tgcttttcgt gcatgatatt aaatagcttg gcagcaacag gactaggatg
     agtagcagca cgttccttat atgtagcttt cgacatgatt tatcttcgtt tcggtttttg
     ttctgtgcag ttgggttaag aatactgggc aatttcatgt ttcttcaaca ctacatatgc
     gtatatatac caatctaagt ctgtgctcct tccttcgttc ttccttctgt tcggagatta
     ccgaatcaaa aaaatttcaa agaaaccgaa atcaaaaaaa agaataaaaa aaaaatgatg
     aattgaaaag ctcttgttac ccatcattga attttgaaca tccgaacctg ggagttttcc
     ctgaaacaga tagtatattt gaacctgtat aataatatat agtctagcgc tttacggaag
     acaatgtatg tatttcggtt cctggagaaa ctattgcatc tattgcatag gtaatcttgc
     acgtcgcatc cccggttcat tttctgcgtt tccatcttgc acttcaatag catatctttg
     ttattttagt agctcgttac agtccggtgc gtttttggtt ttttgaaagt gcgtcttcag
     agcgcttttg gttttcaaaa gcgctctgaa gttcctatac tttctagcta gagaatagga
     acttcggaat aggaacttca aagcgtttcc gaaaacgagc gcttccgaaa atgcaacgcg
     agctgcgcac atacagctca ctgttcacgt cgcacctata tctgcgtgtt gcctgtatat
     atatatacat gagaagaacg gcatagtgcg tgtttatgct taaatgcgtt atggtgcact
     ctcagtacaa tctgctctga tgccgcatag ttaagccagc cccgacaccc gccaacaccc
     gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg cttacagaca agctgtgacc
     gtctccggga gctgcatgtg tcagaggttt tcaccgtcat caccgaaacg cgcgagacga
     aagggcctcg tgatacgcct atttttatag gttaatgtca tgataataat ggtttcttag
     acgt
//