back Return to this vector's summary.
ID   YIP357R    preliminary; circular DNA; SYN; 7102 BP.
XX
AC   ATCC37756;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli plasmid vector YIp357R - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   YEp352E from YEp352 & linker
RC   YEp363A from pNM480 & YEp351
RC   YEp353A from pNM480 & YEp352
RC   YEp353 from YEp353A & YEp352E
RC   YEp354A from pNM481 & YEp352
RC   YEp354 from YEp354A & YEp352E
RC   YEp355A from pNM482 & YEp352
RC   YEp355 from YEp355A & YEp352E
RC   YEp356, YEp356R from YEp353 & pUC18
RC   YEp357, YEp357R from YEp354 & pUC18
RC   YEp358, YEp358R from YEp355 & pUC18
RC   YEp363 from YEp363A & YEp353
RC   YEp364 from YEp363A & YEp354
RC   YEp365 from YEp363A & YEp355
RC   YEp366 from YEp363A & YEp356
RC   YEp367 from YEp363A & YEp357
RC   YEp368 from YEp363A & YEp358
RC   YEp366R from YEp363A & YEp356R
RC   YEp367R from YEp363A & YEp357R
RC   YEp368R from YEp363A & YEp358R
RC   YIp353 from YEp353 & YIp352
RC   YIp354 from YEp354 & YIp352
RC   YIp355 from YEp355 & YIp352
RC   YIp356 from YEp356 & YIp352
RC   YIp357 from YEp357 & YIp352
RC   YIp358 from YEp358 & YIp352
RC   YIp356R from YEp356R & YIp352
RC   YIp357R from YEp357R & YIp352
RC   YIp358R from YEp358R & YIp352
RC   YIp363 from YEp363 & YIp351
RC   YIp364 from YEp364 & YIp351
RC   YIp365 from YEp365 & YIp351
RC   YIp366 from YEp366 & YIp351
RC   YIp367 from YEp367 & YIp351
RC   YIp368 from YEp368 & YIp351
RC   YIp366R from YEp366R & YIp351
RC   YIp367R from YEp367R & YIp351
RC   YIp368R from YEp368R & YIp351
RA   Myers A.M., Tzagoloff A., Kinney D.M., Lusty C.J.;
RT   "Yeast shuttle and integrative vectors with multiple cloning sites
RT   suitable for construction of lacZ fusions";
RL   Gene 45:299-310(1986).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   The sequence and reading frame of the multiple cloning sequence is:
CC   5' A AGC TTG CAT GCC TGC AGG TCG ACT CTA GAG GAT CCC CGG GTA CCG AGC
CC   TCG AAT TCC CAG CTT GCT CCC3', from nucleotide 1 of MCS through CCC
CC   for amino acid 8 of beta-galactosidase.
CC   One of 3 promoter-cloning, YI type shuttle vectors (ATCC 37755 to
CC   ATCC 37757) with URA3 selection in Saccharomyces cerevisiae, a
CC   beta-galactosidase reporter gene and multiple cloning sites differing
CC   in reading frame.
CC   The cleavage position in the reading frame for cloning sites is (where
CC   3 = between triplets): HindIII-3; SphI-1; PstI-1; SalI-3; XbaI-3;
CC   BamHI-3; SmaI-1; KpnI-1; SacI-1; EcoRI-3. The SacI site is not unique.
CC   Restriction digests of the clone give the following sizes (kb):
CC   EcoRI--7.1; SalI--7.1; PstI--7.1; HindIII--7.1. (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (YIp357R)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli HB101)(Saccharomyces cerevisiae)(E.coli)(E.coli MC1061)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (YEp353)(YIp352)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. YEp357R AatII-NcoI 5867bp 5961..7944..3884
FT                   2. YIp352 NcoI-AatII 1198bp 958..2156, URA3/pUC18
FT                   -> YIp357R 7065bp"
FT   -               1..1989
FT                   /note="YEp353 5961..7944..5 1989bp
FT                   EcoRI = G^AATT C
FT                   \              gggaatt..."
FT   -               1990..2054
FT                   /note="65bp
FT                   \ gggaattcgagctcggtacccggggatcctctagagtcgacctgcaggca
FT                   \ gcatgcaagcttccc
FT                   \ ...cttccc
FT                   HindIII = A^AGCTT"
FT   -               2055..2061
FT                   /note="YEp353 32..38 7bp"
FT   -               2062..5904
FT                   /note="YEp353 41..3883 3843bp
FT                   NcoI = C^CATGG"
FT   -               5905..7102
FT                   /note="YIp352 958..2155 1198bp
FT                   AatII = GACGT^C"
FT   misc_binding    0..0
FT                   /note="MCS HindIII-SphI-PstI-SalI-XbaI-BamHI-SmaI-
FT                   KpnI-SacI-EcoRI"
FT   misc_binding    0..0
FT                   /note="SIT unique HindIII-SphI-PstI-SalI-XbaI-BamHI-
FT                   SmaI-KpnI-EcoRI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   CDS             0..0
FT                   /note="ANT yeast URA3 gene"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ);
FT                   reporter gene"
XX
SQ   Sequence 7102 BP; 1712 A; 1814 C; 1778 G; 1798 T; 0 other;
     caggtggcac ttttcgggga aatgtgcgcg gaacccctat ttgtttattt ttctaaatac
     attcaaatat gtatccgctc atgagacaat aaccctgata aatgcttcaa taatattgaa
     aaaggaagag tatgagtatt caacatttcc gtgtcgccct tattcccttt tttgcggcat
     tttgccttcc tgtttttgct cacccagaaa cgctggtgaa agtaaaagat gctgaagatc
     agttgggtgc acgagtgggt tacatcgaac tggatctcaa cagcggtaag atccttgaga
     gttttcgccc cgaagaacgt tttccaatga tgagcacttt taaagttctg ctatgtggcg
     cggtattatc ccgtattgac gccgggcaag agcaactcgg tcgccgcata cactattctc
     agaatgactt ggttgagtac tcaccagtca cagaaaagca tcttacggat ggcatgacag
     taagagaatt atgcagtgct gccataacca tgagtgataa cactgcggcc aacttacttc
     tgacaacgat cggaggaccg aaggagctaa ccgctttttt gcacaacatg ggggatcatg
     taactcgcct tgatcgttgg gaaccggagc tgaatgaagc cataccaaac gacgagcgtg
     acaccacgat gcctgtagca atggcaacaa cgttgcgcaa actattaact ggcgaactac
     ttactctagc ttcccggcaa caattaatag actggatgga ggcggataaa gttgcaggac
     cacttctgcg ctcggccctt ccggctggct ggtttattgc tgataaatct ggagccggtg
     agcgtgggtc tcgcggtatc attgcagcac tggggccaga tggtaagccc tcccgtatcg
     tagttatcta cacgacgggg agtcaggcaa ctatggatga acgaaataga cagatcgctg
     agataggtgc ctcactgatt aagcattggt aactgtcaga ccaagtttac tcatatatac
     tttagattga tttaaaactt catttttaat ttaaaaggat ctaggtgaag atcctttttg
     ataatctcat gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg tcagaccccg
     tagaaaagat caaaggatct tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc
     aaacaaaaaa accaccgcta ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc
     tttttccgaa ggtaactggc ttcagcagag cgcagatacc aaatactgtc cttctagtgt
     agccgtagtt aggccaccac ttcaagaact ctgtagcacc gcctacatac ctcgctctgc
     taatcctgtt accagtggct gctgccagtg gcgataagtc gtgtcttacc gggttggact
     caagacgata gttaccggat aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac
     agcccagctt ggagcgaacg acctacaccg aactgagata cctacagcgt gagcattgag
     aaagcgccac gcttcccgaa gggagaaagg cggacaggta tccggtaagc ggcagggtcg
     gaacaggaga gcgcacgagg gagcttccag ggggaaacgc ctggtatctt tatagtcctg
     tcgggtttcg ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga
     gcctatggaa aaacgccagc aacgcggcct ttttacggtt cctggccttt tgctggcctt
     ttgctcacat gttctttcct gcgttatccc ctgattctgt ggataaccgt attaccgcct
     ttgagtgagc tgataccgct cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg
     aggaagcgga agagcgccca atacgcaaac cgcctctccc cgcgcgttgg ccgattcatt
     cccggaattg ggaattcgag ctcggtaccc ggggatcctc tagagtcgac ctgcaggcag
     catgcaagct tcccagcttg ctcccgccgt cgttttacaa cgtcgtgact gggaaaaccc
     tggcgttacc caacttaatc gccttgcagc acatccccct ttcgccagct ggcgtaatag
     cgaagaggcc cgcaccgatc gcccttccca acagttgcgc agcctgaatg gcgaatggcg
     ctttgcctgg tttccggcac cagaagcggt gccggaaagc tggctggagt gcgatcttcc
     tgaggccgat actgtcgtcg tcccctcaaa ctggcagatg cacggttacg atgcgcccat
     ctacaccaac gtaacctatc ccattacggt caatccgccg tttgttccca cggagaatcc
     gacgggttgt tactcgctca catttaatgt tgatgaaagc tggctacagg aaggccagac
     gcgaattatt tttgatggcg ttaactcggc gtttcatctg tggtgcaacg ggcgctgggt
     cggttacggc caggacagtc gtttgccgtc tgaatttgac ctgagcgcat ttttacgcgc
     cggagaaaac cgcctcgcgg tgatggtgct gcgttggagt gacggcagtt atctggaaga
     tcaggatatg tggcggatga gcggcatttt ccgtgacgtc tcgttgctgc ataaaccgac
     tacacaaatc agcgatttcc atgttgccac tcgctttaat gatgatttca gccgcgctgt
     actggaggct gaagttcaga tgtgcggcga gttgcgtgac tacctacggg taacagtttc
     tttatggcag ggtgaaacgc aggtcgccag cggcaccgcg cctttcggcg gtgaaattat
     cgatgagcgt ggtggttatg ccgatcgcgt cacactacgt ctgaacgtcg aaaacccgaa
     actgtggagc gccgaaatcc cgaatctcta tcgtgcggtg gttgaactgc acaccgccga
     cggcacgctg attgaagcag aagcctgcga tgtcggtttc cgcgaggtgc ggattgaaaa
     tggtctgctg ctgctgaacg gcaagccgtt gctgattcga ggcgttaacc gtcacgagca
     tcatcctctg catggtcagg tcatggatga gcagacgatg gtgcaggata tcctgctgat
     gaagcagaac aactttaacg ccgtgcgctg ttcgcattat ccgaaccatc cgctgtggta
     cacgctgtgc gaccgctacg gcctgtatgt ggtggatgaa gccaatattg aaacccacgg
     catggtgcca atgaatcgtc tgaccgatga tccgcgctgg ctaccggcga tgagcgaacg
     cgtaacgcga atggtgcagc gcgatcgtaa tcacccgagt gtgatcatct ggtcgctggg
     gaatgaatca ggccacggcg ctaatcacga cgcgctgtat cgctggatca aatctgtcga
     tccttcccgc ccggtgcagt atgaaggcgg cggagccgac accacggcca ccgatattat
     ttgcccgatg tacgcgcgcg tggatgaaga ccagcccttc ccggctgtgc cgaaatggtc
     catcaaaaaa tggctttcgc tacctggaga gacgcgcccg ctgatccttt gcgaatacgc
     ccacgcgatg ggtaacagtc ttggcggttt cgctaaatac tggcaggcgt ttcgtcagta
     tccccgttta cagggcggct tcgtctggga ctgggtggat cagtcgctga ttaaatatga
     tgaaaacggc aacccgtggt cggcttacgg cggtgatttt ggcgatacgc cgaacgatcg
     ccagttctgt atgaacggtc tggtctttgc cgaccgcacg ccgcatccag cgctgacgga
     agcaaaacac cagcagcagt ttttccagtt ccgtttatcc gggcaaacca tcgaagtgac
     cagcgaatac ctgttccgtc atagcgataa cgagctcctg cactggatgg tggcgctgga
     tggtaagccg ctggcaagcg gtgaagtgcc tctggatgtc gctccacaag gtaaacagtt
     gattgaactg cctgaactac cgcagccgga gagcgccggg caactctggc tcacagtacg
     cgtagtgcaa ccgaacgcga ccgcatggtc agaagccggg cacatcagcg cctggcagca
     gtggcgtctg gcggaaaacc tcagtgtgac gctccccgcc gcgtcccacg ccatcccgca
     tctgaccacc agcgaaatgg atttttgcat cgagctgggt aataagcgtt ggcaatttaa
     ccgccagtca ggctttcttt cacagatgtg gattggcgat aaaaaacaac tgctgacgcc
     gctgcgcgat cagttcaccc gtgcaccgct ggataacgac attggcgtaa gtgaagcgac
     ccgcattgac cctaacgcct gggtcgaacg ctggaaggcg gcgggccatt accaggccga
     agcagcgttg ttgcagtgca cggcagatac acttgctgat gcggtgctga ttacgaccgc
     tcacgcgtgg cagcatcagg ggaaaacctt atttatcagc cggaaaacct accggattga
     tggtagtggt caaatggcga ttaccgttga tgttgaagtg gcgagcgata caccgcatcc
     ggcgcggatt ggcctgaact gccagctggc gcaggtagca gagcgggtaa actggctcgg
     attagggccg caagaaaact atcccgaccg ccttactgcc gcctgttttg accgctggga
     tctgccattg tcagacatgt ataccccgta cgtcttcccg agcgaaaacg gtctgcgctg
     cgggacgcgc gaattgaatt atggcccaca ccagtggcgc ggcgacttcc agttcaacat
     cagccgctac agtcaacagc aactgatgga aaccagccat cgccatctgc tgcacgcgga
     agaaggcaca tggctgaata tcgacggttt ccatatgggg attggtggcg acgactcctg
     gagcccgtca gtatcggcgg aattccagct gagcgccggt cgctaccatt accagttggt
     ctggtgtcaa aaataataat aaccgggcag gccatgtctg cccgtatttc gcgtaaggaa
     atccattatg tactatttcg cctgatgcgg tattttctcc ttacgcatct gtgcggtatt
     tcacaccgca tagggtaata actgatataa ttaaattgaa gctctaattt gtgagtttag
     tatacatgca tttacttata atacagtttt ttagttttgc tggccgcatc ttctcaaata
     tgcttcccag cctgcttttc tgtaacgttc accctctacc ttagcatccc ttccctttgc
     aaatagtcct cttccaacaa taataatgtc agatcctgta gagaccacat catccacggt
     tctatactgt tgacccaatg cgtctccctt gtcatctaaa cccacaccgg gtgtcataat
     caaccaatcg taaccttcat ctcttccacc catgtctctt tgagcaataa agccgataac
     aaaatctttg tcgctcttcg caatgtcaac agtaccctta gtatattctc cagtagatag
     ggagcccttg catgacaatt ctgctaacat caaaaggcct ctaggttcct ttgttacttc
     ttctgccgcc tgcttcaaac cgctaacaat acctgggccc accacaccgt gtgcattcgt
     aatgtctgcc cattctgcta ttctgtatac acccgcagag tactgcaatt tgactgtatt
     accaatgtca gcaaattttc tgtcttcgaa gagtaaaaaa ttgtacttgg cggataatgc
     ctttagcggc ttaactgtgc cctccatgga aaaatcagtc aagatatcca catgtgtttt
     tagtaaacaa attttgggac ctaatgcttc aactaactcc agtaattcct tggtggtacg
     aacatccaat gaagcacaca agtttgtttg cttttcgtgc atgatattaa atagcttggc
     agcaacagga ctaggatgag tagcagcacg ttccttatat gtagctttcg acatgattta
     tcttcgtttc ggtttttgtt ctgtgcagtt gggttaagaa tactgggcaa tttcatgttt
     cttcaacact acatatgcgt atatatacca atctaagtct gtgctccttc cttcgttctt
     ccttctgttc ggagattacc gaatcaaaaa aatttcaaag aaaccgaaat caaaaaaaag
     aataaaaaaa aaatgatgaa ttgaaaagct cttgttaccc atcattgaat tttgaacatc
     cgaacctggg agttttccct gaaacagata gtatatttga acctgtataa taatatatag
     tctagcgctt tacggaagac aatgtatgta tttcggttcc tggagaaact attgcatcta
     ttgcataggt aatcttgcac gtcgcatccc cggttcattt tctgcgtttc catcttgcac
     ttcaatagca tatctttgtt attttagtag ctcgttacag tccggtgcgt ttttggtttt
     ttgaaagtgc gtcttcagag cgcttttggt tttcaaaagc gctctgaagt tcctatactt
     tctagctaga gaataggaac ttcggaatag gaacttcaaa gcgtttccga aaacgagcgc
     ttccgaaaat gcaacgcgag ctgcgcacat acagctcact gttcacgtcg cacctatatc
     tgcgtgttgc ctgtatatat atatacatga gaagaacggc atagtgcgtg tttatgctta
     aatgcgttat ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccagccc
     cgacacccgc caacacccgc tgacgcgccc tgacgggctt gtctgctccc ggcatccgct
     tacagacaag ctgtgaccgt ctccgggagc tgcatgtgtc agaggttttc accgtcatca
     ccgaaacgcg cgagacgaaa gggcctcgtg atacgcctat ttttataggt taatgtcatg
     ataataatgg tttcttagac gt
//