back Return to this vector's summary.
ID   YIP358     preliminary; circular DNA; SYN; 7085 BP.
XX
AC   ATCC37751;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli plasmid vector YIp358 - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   YEp352E from YEp352 & linker
RC   YEp363A from pNM480 & YEp351
RC   YEp353A from pNM480 & YEp352
RC   YEp353 from YEp353A & YEp352E
RC   YEp354A from pNM481 & YEp352
RC   YEp354 from YEp354A & YEp352E
RC   YEp355A from pNM482 & YEp352
RC   YEp355 from YEp355A & YEp352E
RC   YEp356, YEp356R from YEp353 & pUC18
RC   YEp357, YEp357R from YEp354 & pUC18
RC   YEp358, YEp358R from YEp355 & pUC18
RC   YEp363 from YEp363A & YEp353
RC   YEp364 from YEp363A & YEp354
RC   YEp365 from YEp363A & YEp355
RC   YEp366 from YEp363A & YEp356
RC   YEp367 from YEp363A & YEp357
RC   YEp368 from YEp363A & YEp358
RC   YEp366R from YEp363A & YEp356R
RC   YEp367R from YEp363A & YEp357R
RC   YEp368R from YEp363A & YEp358R
RC   YIp353 from YEp353 & YIp352
RC   YIp354 from YEp354 & YIp352
RC   YIp355 from YEp355 & YIp352
RC   YIp356 from YEp356 & YIp352
RC   YIp357 from YEp357 & YIp352
RC   YIp358 from YEp358 & YIp352
RC   YIp356R from YEp356R & YIp352
RC   YIp357R from YEp357R & YIp352
RC   YIp358R from YEp358R & YIp352
RC   YIp363 from YEp363 & YIp351
RC   YIp364 from YEp364 & YIp351
RC   YIp365 from YEp365 & YIp351
RC   YIp366 from YEp366 & YIp351
RC   YIp367 from YEp367 & YIp351
RC   YIp368 from YEp368 & YIp351
RC   YIp366R from YEp366R & YIp351
RC   YIp367R from YEp367R & YIp351
RC   YIp368R from YEp368R & YIp351
RA   Myers A.M., Tzagoloff A., Kinney D.M., Lusty C.J.;
RT   "Yeast shuttle and integrative vectors with multiple cloning sites
RT   suitable for construction of lacZ fusions";
RL   Gene 45:299-310(1986).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   Restriction digests of the clone give the following sizes (kb):
CC   EcoRI-7.1; SalI-7.1; PstI-7.1; HindIII-7.1. (ATCC staff)
CC   The sequence and reading frame of the multiple cloning sequence is:
CC   5' G AAT TCG AGC TCG GTA CCC GGG GAT CCT CTA GAG TCG ACC TGC AGG CAT
CC   GCA AGC TTC GAT CCC 3', from nucleotide 1 of MCS through CCC for amino
CC   acid 8 of beta-galactosidase.
CC   One of 3 promoter-cloning, YI type shuttle vectors (ATCC 37749 to
CC   ATCC 37751) with URA3 selection in Saccharomyces cerevisiae, a
CC   beta-galactosidase reporter gene and multiple cloning sites differing
CC   in reading frame.
CC   The cleavage position in the reading frame for cloning sites is (where
CC   3 = between triplets): EcoRI-3; SacI-1; KpnI-1; SmaI-3; BamHI-3;
CC   XbaI-3; SalI-3; PstI-1; SphI-1; HindIII-3. The SacI site is not
CC   unique.
CC   Medium is 1227 LB plus ampicillin.
CC   NM (YIp358)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli HB101)(Saccharomyces cerevisiae)(E.coli)(E.coli MC1061)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (YEp353)(YIp352)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. YEp358 AatII-NcoI 5867bp 5961..7944..3884
FT                   2. YIp352 NcoI-AatII 1198bp 958..2156, URA3/pUC18
FT                   -> YIp358 7065bp"
FT   -               1..1985
FT                   /note="YEp353 5961..7944..1 1985bp
FT                   EcoRI = G^AATTC
FT                   \         aattc..."
FT   -               1986..2036
FT                   /note="51bp
FT                   \ aattcgagctcggtacccggggatcctctagagtcgacctgcaggcatgca
FT                   \  ...atgca
FT                   HindIII = A^AGCTT"
FT   -               2037..2041
FT                   /note="YEp353 32..36 5bp"
FT   -               2042..5887
FT                   /note="YEp353 38..3883 3846bp
FT                   NcoI = C^CATGG"
FT   -               5888..7085
FT                   /note="YIp352 958..2155 1198bp
FT                   AatII = GACGT^C"
FT   misc_binding    0..0
FT                   /note="MCS EcoRI-SacI-KpnI-SmaI-BamHI-XbaI-SalI-PstI-
FT                   SphI-HindIII"
FT   misc_binding    0..0
FT                   /note="SIT unique EcoRI-KpnI-SmaI-BamHI-XbaI-SalI-
FT                   PstI-SphI-HindIII"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   CDS             0..0
FT                   /note="ANT yeast URA3 gene"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ);
FT                   reporter gene"
XX
SQ   Sequence 7085 BP; 1709 A; 1809 C; 1773 G; 1794 T; 0 other;
     caggtggcac ttttcgggga aatgtgcgcg gaacccctat ttgtttattt ttctaaatac
     attcaaatat gtatccgctc atgagacaat aaccctgata aatgcttcaa taatattgaa
     aaaggaagag tatgagtatt caacatttcc gtgtcgccct tattcccttt tttgcggcat
     tttgccttcc tgtttttgct cacccagaaa cgctggtgaa agtaaaagat gctgaagatc
     agttgggtgc acgagtgggt tacatcgaac tggatctcaa cagcggtaag atccttgaga
     gttttcgccc cgaagaacgt tttccaatga tgagcacttt taaagttctg ctatgtggcg
     cggtattatc ccgtattgac gccgggcaag agcaactcgg tcgccgcata cactattctc
     agaatgactt ggttgagtac tcaccagtca cagaaaagca tcttacggat ggcatgacag
     taagagaatt atgcagtgct gccataacca tgagtgataa cactgcggcc aacttacttc
     tgacaacgat cggaggaccg aaggagctaa ccgctttttt gcacaacatg ggggatcatg
     taactcgcct tgatcgttgg gaaccggagc tgaatgaagc cataccaaac gacgagcgtg
     acaccacgat gcctgtagca atggcaacaa cgttgcgcaa actattaact ggcgaactac
     ttactctagc ttcccggcaa caattaatag actggatgga ggcggataaa gttgcaggac
     cacttctgcg ctcggccctt ccggctggct ggtttattgc tgataaatct ggagccggtg
     agcgtgggtc tcgcggtatc attgcagcac tggggccaga tggtaagccc tcccgtatcg
     tagttatcta cacgacgggg agtcaggcaa ctatggatga acgaaataga cagatcgctg
     agataggtgc ctcactgatt aagcattggt aactgtcaga ccaagtttac tcatatatac
     tttagattga tttaaaactt catttttaat ttaaaaggat ctaggtgaag atcctttttg
     ataatctcat gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg tcagaccccg
     tagaaaagat caaaggatct tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc
     aaacaaaaaa accaccgcta ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc
     tttttccgaa ggtaactggc ttcagcagag cgcagatacc aaatactgtc cttctagtgt
     agccgtagtt aggccaccac ttcaagaact ctgtagcacc gcctacatac ctcgctctgc
     taatcctgtt accagtggct gctgccagtg gcgataagtc gtgtcttacc gggttggact
     caagacgata gttaccggat aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac
     agcccagctt ggagcgaacg acctacaccg aactgagata cctacagcgt gagcattgag
     aaagcgccac gcttcccgaa gggagaaagg cggacaggta tccggtaagc ggcagggtcg
     gaacaggaga gcgcacgagg gagcttccag ggggaaacgc ctggtatctt tatagtcctg
     tcgggtttcg ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga
     gcctatggaa aaacgccagc aacgcggcct ttttacggtt cctggccttt tgctggcctt
     ttgctcacat gttctttcct gcgttatccc ctgattctgt ggataaccgt attaccgcct
     ttgagtgagc tgataccgct cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg
     aggaagcgga agagcgccca atacgcaaac cgcctctccc cgcgcgttgg ccgattcatt
     cccggaattc gagctcggta cccggggatc ctctagagtc gacctgcagg catgcaagct
     tcgatcccgc cgtcgtttta caacgtcgtg actgggaaaa ccctggcgtt acccaactta
     atcgccttgc agcacatccc cctttcgcca gctggcgtaa tagcgaagag gcccgcaccg
     atcgcccttc ccaacagttg cgcagcctga atggcgaatg gcgctttgcc tggtttccgg
     caccagaagc ggtgccggaa agctggctgg agtgcgatct tcctgaggcc gatactgtcg
     tcgtcccctc aaactggcag atgcacggtt acgatgcgcc catctacacc aacgtaacct
     atcccattac ggtcaatccg ccgtttgttc ccacggagaa tccgacgggt tgttactcgc
     tcacatttaa tgttgatgaa agctggctac aggaaggcca gacgcgaatt atttttgatg
     gcgttaactc ggcgtttcat ctgtggtgca acgggcgctg ggtcggttac ggccaggaca
     gtcgtttgcc gtctgaattt gacctgagcg catttttacg cgccggagaa aaccgcctcg
     cggtgatggt gctgcgttgg agtgacggca gttatctgga agatcaggat atgtggcgga
     tgagcggcat tttccgtgac gtctcgttgc tgcataaacc gactacacaa atcagcgatt
     tccatgttgc cactcgcttt aatgatgatt tcagccgcgc tgtactggag gctgaagttc
     agatgtgcgg cgagttgcgt gactacctac gggtaacagt ttctttatgg cagggtgaaa
     cgcaggtcgc cagcggcacc gcgcctttcg gcggtgaaat tatcgatgag cgtggtggtt
     atgccgatcg cgtcacacta cgtctgaacg tcgaaaaccc gaaactgtgg agcgccgaaa
     tcccgaatct ctatcgtgcg gtggttgaac tgcacaccgc cgacggcacg ctgattgaag
     cagaagcctg cgatgtcggt ttccgcgagg tgcggattga aaatggtctg ctgctgctga
     acggcaagcc gttgctgatt cgaggcgtta accgtcacga gcatcatcct ctgcatggtc
     aggtcatgga tgagcagacg atggtgcagg atatcctgct gatgaagcag aacaacttta
     acgccgtgcg ctgttcgcat tatccgaacc atccgctgtg gtacacgctg tgcgaccgct
     acggcctgta tgtggtggat gaagccaata ttgaaaccca cggcatggtg ccaatgaatc
     gtctgaccga tgatccgcgc tggctaccgg cgatgagcga acgcgtaacg cgaatggtgc
     agcgcgatcg taatcacccg agtgtgatca tctggtcgct ggggaatgaa tcaggccacg
     gcgctaatca cgacgcgctg tatcgctgga tcaaatctgt cgatccttcc cgcccggtgc
     agtatgaagg cggcggagcc gacaccacgg ccaccgatat tatttgcccg atgtacgcgc
     gcgtggatga agaccagccc ttcccggctg tgccgaaatg gtccatcaaa aaatggcttt
     cgctacctgg agagacgcgc ccgctgatcc tttgcgaata cgcccacgcg atgggtaaca
     gtcttggcgg tttcgctaaa tactggcagg cgtttcgtca gtatccccgt ttacagggcg
     gcttcgtctg ggactgggtg gatcagtcgc tgattaaata tgatgaaaac ggcaacccgt
     ggtcggctta cggcggtgat tttggcgata cgccgaacga tcgccagttc tgtatgaacg
     gtctggtctt tgccgaccgc acgccgcatc cagcgctgac ggaagcaaaa caccagcagc
     agtttttcca gttccgttta tccgggcaaa ccatcgaagt gaccagcgaa tacctgttcc
     gtcatagcga taacgagctc ctgcactgga tggtggcgct ggatggtaag ccgctggcaa
     gcggtgaagt gcctctggat gtcgctccac aaggtaaaca gttgattgaa ctgcctgaac
     taccgcagcc ggagagcgcc gggcaactct ggctcacagt acgcgtagtg caaccgaacg
     cgaccgcatg gtcagaagcc gggcacatca gcgcctggca gcagtggcgt ctggcggaaa
     acctcagtgt gacgctcccc gccgcgtccc acgccatccc gcatctgacc accagcgaaa
     tggatttttg catcgagctg ggtaataagc gttggcaatt taaccgccag tcaggctttc
     tttcacagat gtggattggc gataaaaaac aactgctgac gccgctgcgc gatcagttca
     cccgtgcacc gctggataac gacattggcg taagtgaagc gacccgcatt gaccctaacg
     cctgggtcga acgctggaag gcggcgggcc attaccaggc cgaagcagcg ttgttgcagt
     gcacggcaga tacacttgct gatgcggtgc tgattacgac cgctcacgcg tggcagcatc
     aggggaaaac cttatttatc agccggaaaa cctaccggat tgatggtagt ggtcaaatgg
     cgattaccgt tgatgttgaa gtggcgagcg atacaccgca tccggcgcgg attggcctga
     actgccagct ggcgcaggta gcagagcggg taaactggct cggattaggg ccgcaagaaa
     actatcccga ccgccttact gccgcctgtt ttgaccgctg ggatctgcca ttgtcagaca
     tgtatacccc gtacgtcttc ccgagcgaaa acggtctgcg ctgcgggacg cgcgaattga
     attatggccc acaccagtgg cgcggcgact tccagttcaa catcagccgc tacagtcaac
     agcaactgat ggaaaccagc catcgccatc tgctgcacgc ggaagaaggc acatggctga
     atatcgacgg tttccatatg gggattggtg gcgacgactc ctggagcccg tcagtatcgg
     cggaattcca gctgagcgcc ggtcgctacc attaccagtt ggtctggtgt caaaaataat
     aataaccggg caggccatgt ctgcccgtat ttcgcgtaag gaaatccatt atgtactatt
     tcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc gcatagggta
     ataactgata taattaaatt gaagctctaa tttgtgagtt tagtatacat gcatttactt
     ataatacagt tttttagttt tgctggccgc atcttctcaa atatgcttcc cagcctgctt
     ttctgtaacg ttcaccctct accttagcat cccttccctt tgcaaatagt cctcttccaa
     caataataat gtcagatcct gtagagacca catcatccac ggttctatac tgttgaccca
     atgcgtctcc cttgtcatct aaacccacac cgggtgtcat aatcaaccaa tcgtaacctt
     catctcttcc acccatgtct ctttgagcaa taaagccgat aacaaaatct ttgtcgctct
     tcgcaatgtc aacagtaccc ttagtatatt ctccagtaga tagggagccc ttgcatgaca
     attctgctaa catcaaaagg cctctaggtt cctttgttac ttcttctgcc gcctgcttca
     aaccgctaac aatacctggg cccaccacac cgtgtgcatt cgtaatgtct gcccattctg
     ctattctgta tacacccgca gagtactgca atttgactgt attaccaatg tcagcaaatt
     ttctgtcttc gaagagtaaa aaattgtact tggcggataa tgcctttagc ggcttaactg
     tgccctccat ggaaaaatca gtcaagatat ccacatgtgt ttttagtaaa caaattttgg
     gacctaatgc ttcaactaac tccagtaatt ccttggtggt acgaacatcc aatgaagcac
     acaagtttgt ttgcttttcg tgcatgatat taaatagctt ggcagcaaca ggactaggat
     gagtagcagc acgttcctta tatgtagctt tcgacatgat ttatcttcgt ttcggttttt
     gttctgtgca gttgggttaa gaatactggg caatttcatg tttcttcaac actacatatg
     cgtatatata ccaatctaag tctgtgctcc ttccttcgtt cttccttctg ttcggagatt
     accgaatcaa aaaaatttca aagaaaccga aatcaaaaaa aagaataaaa aaaaaatgat
     gaattgaaaa gctcttgtta cccatcattg aattttgaac atccgaacct gggagttttc
     cctgaaacag atagtatatt tgaacctgta taataatata tagtctagcg ctttacggaa
     gacaatgtat gtatttcggt tcctggagaa actattgcat ctattgcata ggtaatcttg
     cacgtcgcat ccccggttca ttttctgcgt ttccatcttg cacttcaata gcatatcttt
     gttattttag tagctcgtta cagtccggtg cgtttttggt tttttgaaag tgcgtcttca
     gagcgctttt ggttttcaaa agcgctctga agttcctata ctttctagct agagaatagg
     aacttcggaa taggaacttc aaagcgtttc cgaaaacgag cgcttccgaa aatgcaacgc
     gagctgcgca catacagctc actgttcacg tcgcacctat atctgcgtgt tgcctgtata
     tatatataca tgagaagaac ggcatagtgc gtgtttatgc ttaaatgcgt tatggtgcac
     tctcagtaca atctgctctg atgccgcata gttaagccag ccccgacacc cgccaacacc
     cgctgacgcg ccctgacggg cttgtctgct cccggcatcc gcttacagac aagctgtgac
     cgtctccggg agctgcatgt gtcagaggtt ttcaccgtca tcaccgaaac gcgcgagacg
     aaagggcctc gtgatacgcc tatttttata ggttaatgtc atgataataa tggtttctta
     gacgt
//