back Return to this vector's summary.
ID   YIP358R    preliminary; circular DNA; SYN; 7103 BP.
XX
AC   ATCC37757;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli plasmid vector YIp358R - complete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   YEp352E from YEp352 & linker
RC   YEp363A from pNM480 & YEp351
RC   YEp353A from pNM480 & YEp352
RC   YEp353 from YEp353A & YEp352E
RC   YEp354A from pNM481 & YEp352
RC   YEp354 from YEp354A & YEp352E
RC   YEp355A from pNM482 & YEp352
RC   YEp355 from YEp355A & YEp352E
RC   YEp356, YEp356R from YEp353 & pUC18
RC   YEp357, YEp357R from YEp354 & pUC18
RC   YEp358, YEp358R from YEp355 & pUC18
RC   YEp363 from YEp363A & YEp353
RC   YEp364 from YEp363A & YEp354
RC   YEp365 from YEp363A & YEp355
RC   YEp366 from YEp363A & YEp356
RC   YEp367 from YEp363A & YEp357
RC   YEp368 from YEp363A & YEp358
RC   YEp366R from YEp363A & YEp356R
RC   YEp367R from YEp363A & YEp357R
RC   YEp368R from YEp363A & YEp358R
RC   YIp353 from YEp353 & YIp352
RC   YIp354 from YEp354 & YIp352
RC   YIp355 from YEp355 & YIp352
RC   YIp356 from YEp356 & YIp352
RC   YIp357 from YEp357 & YIp352
RC   YIp358 from YEp358 & YIp352
RC   YIp356R from YEp356R & YIp352
RC   YIp357R from YEp357R & YIp352
RC   YIp358R from YEp358R & YIp352
RC   YIp363 from YEp363 & YIp351
RC   YIp364 from YEp364 & YIp351
RC   YIp365 from YEp365 & YIp351
RC   YIp366 from YEp366 & YIp351
RC   YIp367 from YEp367 & YIp351
RC   YIp368 from YEp368 & YIp351
RC   YIp366R from YEp366R & YIp351
RC   YIp367R from YEp367R & YIp351
RC   YIp368R from YEp368R & YIp351
RA   Myers A.M., Tzagoloff A., Kinney D.M., Lusty C.J.;
RT   "Yeast shuttle and integrative vectors with multiple cloning sites
RT   suitable for construction of lacZ fusions";
RL   Gene 45:299-310(1986).
XX
CC   Created by Moore, July 1995, under contract with NCBI.
CC   Restriction digests of the clone give the following sizes (kb):
CC   EcoRI-7.1; SalI-7.1; PstI-7.1; HindIII-7.1. (ATCC staff)
CC   The sequence and reading frame of the multiple cloning sequence is:
CC   5' AA GCT TGC ATG CCT GCA GGT CGA CTC TAG AGG ATC CCC GGG TAC CGA GCT
CC   CGA ATT CCC AGC TTC GAT CCC3', from nucleotide 1 of MCS through CCC
CC   for amino acid 8 of beta-galactosidase.
CC   One of 3 promoter-cloning, YI type shuttle vectors (ATCC 37755 to
CC   ATCC 37757) with URA3 selection in Saccharomyces cerevisiae, a
CC   beta-galactosidase reporter gene and multiple cloning sites differing
CC   in reading frame.
CC   The cleavage position in the reading frame for cloning sites is (where
CC   3 = between triplets): HindIII-2; SphI-3; PstI-3; SalI-2; XbaI-2;
CC   BamHI-2; SmaI-3; KpnI-3; SacI-3; EcoRI-2. The SacI site is not unique.
CC   Cloning into the HindIII, SphI, PstI, SalI, or XbaI sites leads to a
CC   TAG stop codon within the downstream XbaI site of the multiple cloning
CC   region.
CC   Medium is 1227 LB plus ampicillin.
CC   NM (YIp358R)
CC   CM (yes)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli HB101)(Saccharomyces cerevisiae)(E.coli)(E.coli MC1061)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (YEp353)(YIp352)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. YEp358R AatII-NcoI 5867bp 5961..7944..3884
FT                   2. YIp352 NcoI-AatII 1198bp 958..2156, URA3/pUC18
FT                   -> YIp358R 7065bp"
FT   -               1..1989
FT                   /note="YEp353 5961..7944..5 1989bp
FT                   EcoRI = G^AATT C
FT                   \              gggaatt..."
FT   -               1990..2054
FT                   /note="65bp
FT                   \ gggaattcgagctcggtacccggggatcctctagagtcgacctgcaggca
FT                   \ gcatgcaagcttccc
FT                   \ ...cttccc
FT                   HindIII = A^AGCTT"
FT   -               2055..2059
FT                   /note="YEp353 32..36 5bp"
FT   -               2060..5905
FT                   /note="YEp353 38..3883 3846bp
FT                   NcoI = C^CATGG"
FT   -               5906..7103
FT                   /note="YIp352 958..2155 1198bp
FT                   AatII = GACGT^C"
FT   misc_binding    0..0
FT                   /note="MCS HindIII-SphI-PstI-SalI-XbaI-BamHI-SmaI-
FT                   KpnI-SacI-EcoRI"
FT   misc_binding    0..0
FT                   /note="SIT unique HindIII-SphI-PstI-SalI-XbaI-BamHI-
FT                   SmaI-KpnI-EcoRI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   CDS             0..0
FT                   /note="ANT yeast URA3 gene"
FT   CDS             0..0
FT                   /note="GEN E. coli beta-galactosidase gene (lacZ);
FT                   reporter gene"
XX
SQ   Sequence 7103 BP; 1713 A; 1814 C; 1778 G; 1798 T; 0 other;
     caggtggcac ttttcgggga aatgtgcgcg gaacccctat ttgtttattt ttctaaatac
     attcaaatat gtatccgctc atgagacaat aaccctgata aatgcttcaa taatattgaa
     aaaggaagag tatgagtatt caacatttcc gtgtcgccct tattcccttt tttgcggcat
     tttgccttcc tgtttttgct cacccagaaa cgctggtgaa agtaaaagat gctgaagatc
     agttgggtgc acgagtgggt tacatcgaac tggatctcaa cagcggtaag atccttgaga
     gttttcgccc cgaagaacgt tttccaatga tgagcacttt taaagttctg ctatgtggcg
     cggtattatc ccgtattgac gccgggcaag agcaactcgg tcgccgcata cactattctc
     agaatgactt ggttgagtac tcaccagtca cagaaaagca tcttacggat ggcatgacag
     taagagaatt atgcagtgct gccataacca tgagtgataa cactgcggcc aacttacttc
     tgacaacgat cggaggaccg aaggagctaa ccgctttttt gcacaacatg ggggatcatg
     taactcgcct tgatcgttgg gaaccggagc tgaatgaagc cataccaaac gacgagcgtg
     acaccacgat gcctgtagca atggcaacaa cgttgcgcaa actattaact ggcgaactac
     ttactctagc ttcccggcaa caattaatag actggatgga ggcggataaa gttgcaggac
     cacttctgcg ctcggccctt ccggctggct ggtttattgc tgataaatct ggagccggtg
     agcgtgggtc tcgcggtatc attgcagcac tggggccaga tggtaagccc tcccgtatcg
     tagttatcta cacgacgggg agtcaggcaa ctatggatga acgaaataga cagatcgctg
     agataggtgc ctcactgatt aagcattggt aactgtcaga ccaagtttac tcatatatac
     tttagattga tttaaaactt catttttaat ttaaaaggat ctaggtgaag atcctttttg
     ataatctcat gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg tcagaccccg
     tagaaaagat caaaggatct tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc
     aaacaaaaaa accaccgcta ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc
     tttttccgaa ggtaactggc ttcagcagag cgcagatacc aaatactgtc cttctagtgt
     agccgtagtt aggccaccac ttcaagaact ctgtagcacc gcctacatac ctcgctctgc
     taatcctgtt accagtggct gctgccagtg gcgataagtc gtgtcttacc gggttggact
     caagacgata gttaccggat aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac
     agcccagctt ggagcgaacg acctacaccg aactgagata cctacagcgt gagcattgag
     aaagcgccac gcttcccgaa gggagaaagg cggacaggta tccggtaagc ggcagggtcg
     gaacaggaga gcgcacgagg gagcttccag ggggaaacgc ctggtatctt tatagtcctg
     tcgggtttcg ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga
     gcctatggaa aaacgccagc aacgcggcct ttttacggtt cctggccttt tgctggcctt
     ttgctcacat gttctttcct gcgttatccc ctgattctgt ggataaccgt attaccgcct
     ttgagtgagc tgataccgct cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg
     aggaagcgga agagcgccca atacgcaaac cgcctctccc cgcgcgttgg ccgattcatt
     cccggaattg ggaattcgag ctcggtaccc ggggatcctc tagagtcgac ctgcaggcag
     catgcaagct tcccagcttc gatcccgccg tcgttttaca acgtcgtgac tgggaaaacc
     ctggcgttac ccaacttaat cgccttgcag cacatccccc tttcgccagc tggcgtaata
     gcgaagaggc ccgcaccgat cgcccttccc aacagttgcg cagcctgaat ggcgaatggc
     gctttgcctg gtttccggca ccagaagcgg tgccggaaag ctggctggag tgcgatcttc
     ctgaggccga tactgtcgtc gtcccctcaa actggcagat gcacggttac gatgcgccca
     tctacaccaa cgtaacctat cccattacgg tcaatccgcc gtttgttccc acggagaatc
     cgacgggttg ttactcgctc acatttaatg ttgatgaaag ctggctacag gaaggccaga
     cgcgaattat ttttgatggc gttaactcgg cgtttcatct gtggtgcaac gggcgctggg
     tcggttacgg ccaggacagt cgtttgccgt ctgaatttga cctgagcgca tttttacgcg
     ccggagaaaa ccgcctcgcg gtgatggtgc tgcgttggag tgacggcagt tatctggaag
     atcaggatat gtggcggatg agcggcattt tccgtgacgt ctcgttgctg cataaaccga
     ctacacaaat cagcgatttc catgttgcca ctcgctttaa tgatgatttc agccgcgctg
     tactggaggc tgaagttcag atgtgcggcg agttgcgtga ctacctacgg gtaacagttt
     ctttatggca gggtgaaacg caggtcgcca gcggcaccgc gcctttcggc ggtgaaatta
     tcgatgagcg tggtggttat gccgatcgcg tcacactacg tctgaacgtc gaaaacccga
     aactgtggag cgccgaaatc ccgaatctct atcgtgcggt ggttgaactg cacaccgccg
     acggcacgct gattgaagca gaagcctgcg atgtcggttt ccgcgaggtg cggattgaaa
     atggtctgct gctgctgaac ggcaagccgt tgctgattcg aggcgttaac cgtcacgagc
     atcatcctct gcatggtcag gtcatggatg agcagacgat ggtgcaggat atcctgctga
     tgaagcagaa caactttaac gccgtgcgct gttcgcatta tccgaaccat ccgctgtggt
     acacgctgtg cgaccgctac ggcctgtatg tggtggatga agccaatatt gaaacccacg
     gcatggtgcc aatgaatcgt ctgaccgatg atccgcgctg gctaccggcg atgagcgaac
     gcgtaacgcg aatggtgcag cgcgatcgta atcacccgag tgtgatcatc tggtcgctgg
     ggaatgaatc aggccacggc gctaatcacg acgcgctgta tcgctggatc aaatctgtcg
     atccttcccg cccggtgcag tatgaaggcg gcggagccga caccacggcc accgatatta
     tttgcccgat gtacgcgcgc gtggatgaag accagccctt cccggctgtg ccgaaatggt
     ccatcaaaaa atggctttcg ctacctggag agacgcgccc gctgatcctt tgcgaatacg
     cccacgcgat gggtaacagt cttggcggtt tcgctaaata ctggcaggcg tttcgtcagt
     atccccgttt acagggcggc ttcgtctggg actgggtgga tcagtcgctg attaaatatg
     atgaaaacgg caacccgtgg tcggcttacg gcggtgattt tggcgatacg ccgaacgatc
     gccagttctg tatgaacggt ctggtctttg ccgaccgcac gccgcatcca gcgctgacgg
     aagcaaaaca ccagcagcag tttttccagt tccgtttatc cgggcaaacc atcgaagtga
     ccagcgaata cctgttccgt catagcgata acgagctcct gcactggatg gtggcgctgg
     atggtaagcc gctggcaagc ggtgaagtgc ctctggatgt cgctccacaa ggtaaacagt
     tgattgaact gcctgaacta ccgcagccgg agagcgccgg gcaactctgg ctcacagtac
     gcgtagtgca accgaacgcg accgcatggt cagaagccgg gcacatcagc gcctggcagc
     agtggcgtct ggcggaaaac ctcagtgtga cgctccccgc cgcgtcccac gccatcccgc
     atctgaccac cagcgaaatg gatttttgca tcgagctggg taataagcgt tggcaattta
     accgccagtc aggctttctt tcacagatgt ggattggcga taaaaaacaa ctgctgacgc
     cgctgcgcga tcagttcacc cgtgcaccgc tggataacga cattggcgta agtgaagcga
     cccgcattga ccctaacgcc tgggtcgaac gctggaaggc ggcgggccat taccaggccg
     aagcagcgtt gttgcagtgc acggcagata cacttgctga tgcggtgctg attacgaccg
     ctcacgcgtg gcagcatcag gggaaaacct tatttatcag ccggaaaacc taccggattg
     atggtagtgg tcaaatggcg attaccgttg atgttgaagt ggcgagcgat acaccgcatc
     cggcgcggat tggcctgaac tgccagctgg cgcaggtagc agagcgggta aactggctcg
     gattagggcc gcaagaaaac tatcccgacc gccttactgc cgcctgtttt gaccgctggg
     atctgccatt gtcagacatg tataccccgt acgtcttccc gagcgaaaac ggtctgcgct
     gcgggacgcg cgaattgaat tatggcccac accagtggcg cggcgacttc cagttcaaca
     tcagccgcta cagtcaacag caactgatgg aaaccagcca tcgccatctg ctgcacgcgg
     aagaaggcac atggctgaat atcgacggtt tccatatggg gattggtggc gacgactcct
     ggagcccgtc agtatcggcg gaattccagc tgagcgccgg tcgctaccat taccagttgg
     tctggtgtca aaaataataa taaccgggca ggccatgtct gcccgtattt cgcgtaagga
     aatccattat gtactatttc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat
     ttcacaccgc atagggtaat aactgatata attaaattga agctctaatt tgtgagttta
     gtatacatgc atttacttat aatacagttt tttagttttg ctggccgcat cttctcaaat
     atgcttccca gcctgctttt ctgtaacgtt caccctctac cttagcatcc cttccctttg
     caaatagtcc tcttccaaca ataataatgt cagatcctgt agagaccaca tcatccacgg
     ttctatactg ttgacccaat gcgtctccct tgtcatctaa acccacaccg ggtgtcataa
     tcaaccaatc gtaaccttca tctcttccac ccatgtctct ttgagcaata aagccgataa
     caaaatcttt gtcgctcttc gcaatgtcaa cagtaccctt agtatattct ccagtagata
     gggagccctt gcatgacaat tctgctaaca tcaaaaggcc tctaggttcc tttgttactt
     cttctgccgc ctgcttcaaa ccgctaacaa tacctgggcc caccacaccg tgtgcattcg
     taatgtctgc ccattctgct attctgtata cacccgcaga gtactgcaat ttgactgtat
     taccaatgtc agcaaatttt ctgtcttcga agagtaaaaa attgtacttg gcggataatg
     cctttagcgg cttaactgtg ccctccatgg aaaaatcagt caagatatcc acatgtgttt
     ttagtaaaca aattttggga cctaatgctt caactaactc cagtaattcc ttggtggtac
     gaacatccaa tgaagcacac aagtttgttt gcttttcgtg catgatatta aatagcttgg
     cagcaacagg actaggatga gtagcagcac gttccttata tgtagctttc gacatgattt
     atcttcgttt cggtttttgt tctgtgcagt tgggttaaga atactgggca atttcatgtt
     tcttcaacac tacatatgcg tatatatacc aatctaagtc tgtgctcctt ccttcgttct
     tccttctgtt cggagattac cgaatcaaaa aaatttcaaa gaaaccgaaa tcaaaaaaaa
     gaataaaaaa aaaatgatga attgaaaagc tcttgttacc catcattgaa ttttgaacat
     ccgaacctgg gagttttccc tgaaacagat agtatatttg aacctgtata ataatatata
     gtctagcgct ttacggaaga caatgtatgt atttcggttc ctggagaaac tattgcatct
     attgcatagg taatcttgca cgtcgcatcc ccggttcatt ttctgcgttt ccatcttgca
     cttcaatagc atatctttgt tattttagta gctcgttaca gtccggtgcg tttttggttt
     tttgaaagtg cgtcttcaga gcgcttttgg ttttcaaaag cgctctgaag ttcctatact
     ttctagctag agaataggaa cttcggaata ggaacttcaa agcgtttccg aaaacgagcg
     cttccgaaaa tgcaacgcga gctgcgcaca tacagctcac tgttcacgtc gcacctatat
     ctgcgtgttg cctgtatata tatatacatg agaagaacgg catagtgcgt gtttatgctt
     aaatgcgtta tggtgcactc tcagtacaat ctgctctgat gccgcatagt taagccagcc
     ccgacacccg ccaacacccg ctgacgcgcc ctgacgggct tgtctgctcc cggcatccgc
     ttacagacaa gctgtgaccg tctccgggag ctgcatgtgt cagaggtttt caccgtcatc
     accgaaacgc gcgagacgaa agggcctcgt gatacgccta tttttatagg ttaatgtcat
     gataataatg gtttcttaga cgt
//