back Return to this vector's summary.
ID   EMBL4      preliminary; circular DNA; SYN; 43000 BP.
XX
AC   X58667; X58668; X06780; IG1004; ATCC37267;
XX
DT   02-NOV-1992 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli phage vector lambda EMBL4 - incomplete.
XX
KW   cloning vector.
XX
OS   Bacteriophage lambda
OC   Viridae; ds-DNA nonenveloped viruses; Siphoviridae.
XX
RN   [1]
RC   EMBL1 from lambda 1059 & pBR322
RC   EMBL2 from EMBL1
RC   EMBL2Sal, EMBL2RI from EMBL2
RC   [pUC2 from M13mp2]
RC   pUC(S-Bg), pUC(R-Bg) from pUC2
RC   EMBL3 from EMBL2Sal & EMBL2RI & pUC(S-Bg)
RC   EMBL4 from EMBL2Sal & EMBL2RI & pUC(R-Bg)
RC   EMBL3AamBam, EMBL3Sam7, EMBL3Aam, EMBL3Bam from EMBL3
RC   EMBL3AamSam, EMBL3BamSam from EMBL3
RA   Frischauf A.M., Lehrach H., Poustka A., Murray N.E.;
RT   "Lambda replacement vectors carrying polylinker sequences";
RL   J. Mol. Biol. 170:827-842(1983).
XX
RN   [2]
RC   EMBL3, polylinker
RC   EMBL4, polylinker
RA   Goedert M., Rogers J., Wilson P.W.;
RT   ;
RL   Submitted (08-FEB-1988) to GenBank by:
RL   Goedert M., Rogers J., Wilson P.W.,
RL   Department of Physiology, University of Cambridge, Downing Street,
RL   Cambridge CB2 3EG, UNITED KINGDOM.
XX
RN   [3]
RC   EMBL3, polylinker
RC   EMBL4, polylinker
RA   Schulman A.H.;
RT   ;
RL   Submitted (27-MAR-1991) to GenBank by:
RL   Schulman A.H., Institute of Biotechnology, University of Helsinki,
RL   Karvaamokuja 3, SF-00380 Helsinki, FINLAND.
XX
CC   EMBL4 size is between 43000 and 44000 bp.
CC   left arm is 19300. right arm is 9200 bp. The stuffer is 1400 bp.
CC   Phage with inserts have the Spi- phenotype. [3]
CC   lambdaEMBL3 (ATCC 37266) and lambdaEMBL4 (ATCC 37267) differ only in
CC   the orientation of the MCS surrounding the stuffer fragment.
CC   Medium is 1592 SM buffer.
CC   NM (lambda EMBL4)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)(linear)
CC   ST ()
CC   TY (phage)
CC   SP (CLONTECH)(Promega)(Stratagene)(ATCC)
CC   HO (E.coli LE392)(E.coli O358)(E.coli O359)(E.coli K802)
CC   HO (E.coli NM538)(E.coli NM539)(E.coli KW251)
CC   HO (E.coli XL-1-Blue MRA)(E.coli XL-1-Blue MRA P2)
CC   CP ()
CC   FN (cloning 8000-23000 bp)(chromosome walking)
CC   SE ()
CC   PA (lambda 1059)
CC   BR (EMBL3)
CC   OF ()
CC   OR (E.coli Y1090)
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. lambda 1059 remove middle HindIII-HindIII
FT                   \ 21011bp, lambda 23131..44142/27491bp
FT                   \ lambda 23131 25158 27480 36896 37460 44142
FT                   2. E. coli HindIII-HindIII 5700bp, trpE gene
FT                   -> EMBL1 33200bp
FT                   1. EMBL1 EcoRI, lambda 21227
FT                   \ lambda 21227 26105 31748 39169 44973
FT                   mutation
FT                   EcoRI, lambda 44973
FT                   mutation
FT                   -> EMBL2 33200bp [no EcoRI]
FT                   1. M13mp2, MCS
FT                   -> pUC2
FT                   1. pUC2 EcoRI 2200bp, pUC4 327 or 369
FT                   EcoRI-BglII-EcoRI linker 18bp gaattcagatctgaattc
FT                   EcoRI-EcoRI
FT                   -> pUC(R-Bg) 2200bp [EcoRI-BglII-EcoRI]
FT                   1. pUC2 SalI 2200bp, pUC4 342 or 354
FT                   SalI-BglII-SalI linker 18bp gtcgacagatctgtcgac
FT                   SalI-SalI
FT                   -> pUC(S-Bg) 2200bp
FT                   \ [EcoRI-BamHI-SalI-BglII-SalI-BamHI-EcoRI]
FT                   1. EMBL2 remove small BamHI-BamHI
FT                   \ 16841bp lambda 5506..22347/16359bp
FT                   \ lambda 5506 22347 27973 34500 41733
FT                   2. pUC(R-Bg) BglII 2200bp
FT                   -> EMBLRI
FT                   1. EMBL2 remove small BamHI-BamHI
FT                   \ 16841bp lambda 5506..22347/16359bp
FT                   \ lambda 5506 22347 27973 34500 41733
FT                   2. pUC(S-Bg) BglII 2200bp
FT                   -> EMBLSal
FT                   1. EMBLRI remove middle EcoRI-EcoRI 2200bp
FT                   2. E. coli EcoRI-EcoRI
FT                   -> phage
FT                   1. EMBLSal remove middle EcoRI-EcoRI 2200bp
FT                   2. E. coli EcoRI-EcoRI
FT                   -> phage2
FT                   1. EMBLRI middle EcoRI-EcoRI 2200bp
FT                   2. phage2 remove middle EcoRI-EcoRI, 27000bp
FT                   -> EMBL3 29237bp
FT                   1. EMBLSal middle EcoRI-EcoRI 2200bp
FT                   2. phage remove middle EcoRI-EcoRI, 40800bp
FT                   -> EMBL4 43000bp"
FT   misc_binding    0..0
FT                   /note="MCS double SalI-BamHI-EcoRI-EcoRI-BamHI-SalI
FT                   ggatctgggtcgaccggtcgacccagatctgggtcgacctgcaggtcaa
FT                   cggatccgttgacctgcaggtcgacccagatcc"
FT   misc_binding    0..0
FT                   /note="SIT EcoRI-EcoRI, left and right arms,
FT                   ggatctgggtcgaccggtcgacccagatctgggtcgacctgcaggtcaa
FT                   cggatccgttgacctgcaggtcgacccagatcc"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT PvuI"
FT   misc_binding    0..0
FT                   /note="SIT KpnI"
FT   misc_binding    0..0
FT                   /note="SIT KpnI"
FT   misc_binding    0..0
FT                   /note="SIT SmaI"
FT   misc_feature    0..0
FT                   /note="bacteriophage lambda 2001 stuffer fragment
FT                   (13700 bp)"
FT   CDS             0..0
FT                   /note="GEN bacteriophage lambda red+"
FT   CDS             0..0
FT                   /note="GEN bacteriophage lambda gam+"
FT   misc_binding    0..0
FT                   /note="SIT SmaI"
FT   misc_binding    0..0
FT                   /note="SIT SalI"
FT   misc_binding    0..0
FT                   /note="SIT SalI"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT PvuI"
FT   misc_binding    0..0
FT                   /note="SIT HindIII"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT HindIII"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT BglII"
FT   misc_binding    0..0
FT                   /note="SIT SmaI"
FT   misc_binding    0..0
FT                   /note="SIT SstI"
FT   misc_binding    0..0
FT                   /note="SIT HindIII"
FT   rep_origin      0..0
FT                   /note="ORI bacteriophage lambda"
FT   CDS             0..0
FT                   /note="GEN bacteriophage lambda Spi+ reporter gene"
XX
SQ   Sequence 736 BP; 122 A; 113 C; 111 G; 150 T; 240 other;
     ttggcattat aaaaaagcat tgcttatcaa tttgttgcaa cgaacaggtc actatcagtc
     aaaataaaat cattatttga tttcaatttt gtcccactcc ctgcctctgt catcacgata
     ctgtgatgcc atggtgtccg acttatgccc gagaagatgt tgagcaaact tatcgcttat
     ctgcttctca tagagtcttg cagacaaact gcgcaactcg tgaaaggtag gcnnnnnnnn
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn
     nnggatctgg gtcgaccggt cgacccagat ctgggtcgac ctgcaggtca acggatccnn
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn
     nnnnnnnngt tgacctgcag gtcgacccag atccnnnnnn nnnnnnnnnn nnnnnnnnnn
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn
     nnnnactcgt tattctcgga cgagtgttca gtaatgaacc tctggagaga nnnnnnnnnn
     accatgtata tgatcgttat ctgggttgga cttctgcttt taagcccaga taactggcct
     gaatatgtta atgagagaat cggtattcct catgtgtggc atgttttcgt ctttgctctt
     gcattttcgc tagcaa
//