back Return to this vector's summary.
ID   IA         preliminary; circular DNA; SYN; 61 BP.
XX
AC   M60893; M60892;
XX
DT   26-MAR-1991 (Rel. 6, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli plasmid vector I-a - incomplete, Tn5 element O end/I end.
XX
KW   cloning vector; Tn5; transposon.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-61
RC   I from pBR322 & pBRG1305 & pLS302
RC   II from pBR322 & pBRG1305 & pLS302
RC   I-a from I & pUC4K, kan gene
RC   II-a from II & pUC4K, kan gene
RA   Tomcsanyi T., Berg C.M., Phadnis S.H., Berg D.E.;
RT   "Intramolecular transposition by a synthetic IS50 (Tn5) derivative";
RL   J. Bacteriol. 172:6348-6354(1990).
XX
RN   [2]
RC   pBRG1305, pBRG1306 from pMOJ7 & pGC1 & pBRG700 & linker
RC   from pBRG1305
RC   from pBRG1306
RA   Phadnis S.H., Berg D.E.;
RT   "Identification of base pairs in the IS50 O end needed for IS50
RT   and Tn5 transposition";
RL   Proc. Natl. Acad. Sci. U.S.A. 84:9118-9122(1987).
XX
RN   [3]
RC   pLS23 from pLS14
RC   pLS80 from pUC8 & pLS50
RC   pLS30 from pJH101 & pLS80
RC   pLS51 from pLS50
RC   pLS52 from pLS51
RC   pLS151, pLS152 from pLS51
RC   pLS301 from pUC8 & pLS52, B.subtilis sacB gene
RC   pLS302 from pLS301 & pLS51
RC   pLS308, pLS310 from pBR322 & pLS301
RA   Steinmetz M., Le Coq D., Aymerich S., Gonzy-Treboul G., Gay P.;
RT   "The DNA sequence of the gene for the secreted Bacillus subtilis
RT   enzyme levansucrase and its genetic control sites";
RL   Mol. Gen. Genet. 200:220-228(1985).
XX
RN   [4]
RC   pLS14 from sacB gene
RC   pLS50 from sacB gene
RA   Steinmetz M., Le Coq D., Ben Djemia H., Gay P.;
RT   "Analyse genetique de sacB, gene de structure d'une enzyme secretee,
RT   la levane-saccharase de B. subtilis";
RL   Mol. Gen. Genet. 191:138-144(1983).
XX
RN   [5]
RC   pMOJ7 from pBR322 & M13
RA   Barnes W.M.;
RT   ;
RL   Unpublished (1987).
XX
RN   [6]
RC   pBRG700 from Tn5, IS50
RA   Sasakawa C., Carle G.F., Berg D.E.;
RT   "Sequences essential for transposition at the termini of IS50";
RL   Proc. Natl. Acad. Sci. U.S.A. 80:7293-7297(1983).
XX
CC   NCBI gi: 209014
CC   NCBI gi: 209013
CC   NM (I-a)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 PvuII 4361bp 2067..2067
FT                   2. pC194 HpaII-MboI 1030bp 975..2005, cat gene
FT                   -> pJH101 5400bp
FT                   1. pJH101 HindIII 5400bp 30..30
FT                   2. B.subtilis HindIII-HindIII 4900bp, IS1/sacB/sacR
FT                   -> pLS50 10300bp
FT                   1. pLS50 remove Sau3A/MboI-Sau3A/MboI 2500bp,
FT                   \ 3' to sacR to tet
FT                   -> pLS51 7800bp [unique Sau3A/MboI]
FT                   1. pLS51 remove EcoRI-EcoRI 2900bp, IS1/sacB gene
FT                   -> pLS52 4900bp
FT                   1. pUC8 remove EcoRI-BamHI 10bp 231..241, MCS/2655bp
FT                   2. pLS52 Sau3A/MboI-EcoRI, 3' B.subtilis sacB gene
FT                   -> pLS301
FT                   1. pLS301 EcoRI 231..231
FT                   2. pLS51 EcoRI-EcoRI, 5' sacB gene
FT                   -> pLS302
FT                   1. pBR322 PvuII 4361bp 2067..2067
FT                   2. M13, ori
FT                   -> pMOJ7
FT                   1. IS50, tet gene
FT                   -> pBRG700
FT                   1. pMOJ7 KpnI-EcoRI, M13 ori/ori/amp gene
FT                   2. pGC1 HindIII-ClaI 300bp
FT                   EcoRI linker 6bp gaattc:
FT                   EcoRI-ClaI, GC clamp/19bp primer
FT                   3. oligo ClaI-SacI-I end-BamHI-O end-KpnI 107bp
FT                   \ ctggcacgcgctggacgcgcatcgataagctcgagctcgagctttaatg
FT                   \ ctgtctcttgatcagatctcgggatcccctacttgtgtataagagtcag
FT                   \ ggtaccc, includes pBRG700 I end
FT                   -> pBRG1305 4000bp
FT                   1. pBR322 BamHI 4361bp 376..376, tet gene
FT                   mutagenesis
FT                   BamHI-NdeI 1924bp 376..2299, tet/ori
FT                   2. pBRG1305 BamHI-BamHI, IS50 O/IS50 I/tnp gene
FT                   3. pLS302 EcoRI
FT                   linker 29bp tatcaagttcctgagttcgattcgtccac
FT                   BamHI-NdeI, sacB gene
FT                   \ pUC8 241..-..478
FT                   -> I 6300bp
FT                   1. I EcoRI 6300bp, 5' to sacB gene
FT                   2. pUC4K EcoRI-EcoRI 1282bp 397..1679, kan gene
FT                   -> I-a 7800bp"
FT   misc_feature    1..20
FT                   /note="primer #2"
FT   misc_feature    37..55
FT                   /note="plasmid I-a O end"
FT   misc_feature    1..20
FT                   /note="primer #1"
FT   misc_feature    24..42
FT                   /note="plasmid I end"
XX
SQ   Sequence 179 BP; 36 A; 22 C; 34 G; 28 T; 59 other;
     cggcaggtat atgtcatggg ttaaaaagga tcccctactt gtgtataaga gtcagggtac
     cnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn
     ggatctgatg gcgcagggga tcaagatctg atcaagagac agcattaaag ctcgaattc
//