back Return to this vector's summary.
ID   IAIIA      preliminary; circular DNA; SYN; 59 BP.
XX
AC   M60892;
XX
DT   26-MAR-1991 (Rel. 6, Created)
DT   01-APR-1995 (Rel. 11, Last updated, Version 1)
XX
DE   E. coli plasmid vector I-a and II-a  - incomplete, Tn5 element I end.
XX
KW   cloning vector; Tn5; transposon.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RP   1-59
RC   I from pBR322 & pBRG1305 & pLS302
RC   II from pBR322 & pBRG1305 & pLS302
RC   I-a from I & pUC4K, kan gene
RC   II-a from II & pUC4K, kan gene
RA   Tomcsanyi T., Berg C.M., Phadnis S.H., Berg D.E.;
RT   "Intramolecular transposition by a synthetic IS50 (Tn5) derivative";
RL   J. Bacteriol. 172:6348-6354(1990).
XX
CC   NCBI gi: 209013
CC   NM (I-a)(II-a)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP ()
CC   HO (E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBRG700
FT                   -> pBRG700
FT                   1. pBR322
FT                   2. M13
FT                   -> pMOJ7
FT                   1. sacB gene
FT                   -> pLS50
FT                   1. pLS50
FT                   -> pLS51
FT                   1. pLS51
FT                   -> pLS52
FT                   1. pUC8
FT                   2. pLS52, B.subtilis sacB gene
FT                   -> pLS301
FT                   1. pLS301
FT                   2. pLS51
FT                   -> pLS302
FT                   1. pMOJ7
FT                   2. pGC1
FT                   3. pBRG700
FT                   4. linker
FT                   -> pBRG1305
FT                   1. pBR322 BamHI, tet gene
FT                   mutagenesis
FT                   BamHI-NdeI, tet/ori
FT                   2. pBRG1305 BamHI-BamHI, IS50 O/IS50 I/tnp gene
FT                   3. pLS302 EcoRI
FT                   linker tatcaagttcctgagttcgattcgtccac
FT                   BamHI-NdeI, sacB gene
FT                   -> II 6300bp
FT                   1. II EcoRI, 5' to sacB gene
FT                   2. pUC4K EcoRI-EcoRI 1500bp, kan gene
FT                   -> II-a 7800bp"
FT   misc_feature    1..20
FT                   /note="primer #1"
FT   misc_feature    24..42
FT                   /note="plasmid I end"
XX
SQ   Sequence 59 BP; 19 A; 11 C; 17 G; 12 T; 0 other;
     ggatctgatg gcgcagggga tcaagatctg atcaagagac agcattaaag ctcgaattc
//